🕷️ Crawler Inspector

URL Lookup

Direct Parameter Lookup

Raw Queries and Responses

1. Shard Calculation

Query:

Response:

Calculated Shard: 145 (from laksa045)

2. Crawled Status Check

Query:

curl -X POST \
  'http://laksa145.int.ahrefs:8124/' \
  -H 'Content-Type: text/plain' \
  -H 'X-ClickHouse-Database: crawler3' \
  -H 'Authorization: Basic YXBpOg==' \
  -d 'SELECT getAhrefsURLFromUnparsed(src_unparsed) AS found_url, ifNull(toUnixTimestamp(download_stamp), 0) AS crawl_time, ifNull(toUnixTimestamp(props_url_first_seen), 0) AS first_indexed_time, download_http_code AS http_code, src_unparsed AS src_unparsed, src_root_hash AS src_root_hash, history_drop_reason AS history_drop_reason, meta_title AS meta_title, meta_descriptions AS meta_descriptions, attrs_boilerpipe_text AS attrs_boilerpipe_text, attrs_markdown AS attrs_markdown, attrs_readable_markdown AS attrs_readable_markdown, meta_canonical AS meta_canonical FROM crawler3.page_info_local FINAL PREWHERE (src_root_hash, src_unparsed) IN ((getAhrefsRootHashFromUnparsed(getAhrefsUnparsedNoserviceFromURL(\'https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full\')), getAhrefsUnparsedNoserviceFromURL(\'https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full\'))) FORMAT JSONEachRow'

Response:

{"found_url":"https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full","crawl_time":1775324468,"first_indexed_time":1730293290,"http_code":200,"src_unparsed":"org,frontiersin!www,\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full s443","src_root_hash":"4240109820602890345","history_drop_reason":null,"meta_title":"Frontiers | Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon","meta_descriptions":["Diarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the e...","Diarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the e..."],"attrs_boilerpipe_text":"Abstract\nDiarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the epithelial ion transport in lactose-induced diarrhea remain unclear. The present study aimed to investigate the effect of an incremental high-lactose diet (IHLD, 30%\/40%\/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. Gut microbiota were analyzed by 16S rRNA amplicon sequencing and the concentration of SCFAs by gas chromatography, galactose, lactose and lactic acid through assay kit; Ussing chamber was performed to detect basal and stimulated ion transport; The expression and location of SCFA transporters, the Na-H exchanger 3(NHE3), cystic fibrosis transporter regulater (CFTR) and NKCC1 in the colon mucosa were analyzed by western and immunostaining. The concentrations of lactose, galactose and lactic acid of the cecal content were markedly increased (\nP\n< 0.01) and SCFA concentration was significantly decreased (\nP\n< 0.01). This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and increased relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. The expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels, and decreases in delta basal short circuit current after apical Na\n+\nremoval in the colonic mucosa of the IHLD group contributed to Na\n+\naccumulation in the lumen and decrease stimulated Cl\n–\nsecretion with low CFTR and NKCC1 expression would compensate for water and electrolyte loss during the diarrhea process. These results indicated that the persistence of the diarrhea state was maintained by abnormal colonic microbiota fermentation leading to high concentrations of lactose, galactose and lactic acid and low SCFAs in the lumen, and decreased Na\n+\nabsorption with the low NHE3 expression and phosphorylation levels.\nIntroduction\nDiarrhea is a highly prevalent and bothersome disorder, particularly in children and the elderly. According to the WHO, it is estimated that 577,000 children aged <5 years and 502,000 adults aged >70 years will die from diarrheal diseases worldwide (\nThapar and Sanderson, 2004\n;\nBryce et al., 2005\n;\nWardlaw et al., 2010\n). Long-standing diarrhea causes malnutrition, which in turn leads to more difficulty in treating. Approximately 70% of the world’s population has hypolactasia after weaning, resulting in lactose malabsorption or lactose intolerance, defined as the presence of gastrointestinal symptoms such as bloating, rumbling, abdominal pain, nausea and diarrhea (\nSwagerty et al., 2002\n;\nBayless et al., 2017\n;\nFassio et al., 2018\n).\nAs we know, lactose intolerance-induced diarrhea belongs to osmotic diarrhea, thereby resulting in colonic water and electrolyte accumulation (\nHammer and Hammer, 2012\n). It is believed that the osmotic load is not only caused by undigested lactose but that the colonic fermentation capacity plays a role in lactose intolerance (\nHe et al., 2006\n). Lactose is fermented by the colonic resident microbiota into a series of intermediate and end-product metabolites, including lactate, formate, succinate and short-chain fatty acids (SCFAs), including acetate, propionate and butyrate (\nHe et al., 2006\n;\nWindey et al., 2015\n). Some reports have indicated that the osmolality of lactose-induced diarrhea is closely linked to the lactose content and the production of SCFAs in the colon (\nBinder, 2010\n;\nAlexandre et al., 2013\n). SCFAs are the main anions of the colon, which have been demonstrated to be novel regulators of colonic ion transport (\nYajima et al., 2011\n;\nKaji et al., 2016\n). Therefore, we speculated that the mechanism of lactose-induced diarrhea involved a change in SCFAs or lactate leading to a disturbance in colonic epithelial ion transport resulting in diarrhea. In the process of the transport of SCFAs, monocarboxylate (MCT1) and sodium MCT1 (sMCT1) transporters play an important role in mediating SCFA influx into the blood from the lumen (\nRitzhaupt et al., 1998\n;\nGanapathy et al., 2005\n;\nSivaprakasam et al., 2017\n).\nIt is commonly recognized that diarrhea results from excessive secretion and\/or impaired absorption of fluid and electrolytes across the intestinal epithelium. Excessive fluid secretion is caused by active chloride secretion into the intestinal lumen, which drives secondary movement of sodium and water (\nBinder et al., 1991\n;\nHoque et al., 2012\n). Chloride secretion involves the activation of chloride channel(s), such as CFTR, on the apical plasma membrane, and it is transported into the cell at the basolateral membrane by a Na\/K\/Cl symporter (NKCC1, also known as SLC12A2) (\nKunzelmann and Mall, 2002\n). Na\n+\nabsorption includes electrogenic Na\n+\nabsorption mediated by epithelial Na\n+\nchannels (ENaC), whereas electroneutral Na\n+\nabsorption is mediated by the Na-H exchanger (NHE) and Cl\n–\n-HCO\n3\n-\nexchanger (an anion exchanger; AE) (\nBinder et al., 1987\n). NHE3 mediates both HCO\n3\n-dependent and butyrate-dependent Na\n+\nabsorption in the normal gut, which is regulated by butyrate (\nSubramanya et al., 2007\n), inducing NHE3 expression and increasing Na\n+\nabsorption in the rat colon (\nMusch et al., 2001\n;\nVidyasagar and Ramakrishna, 2002\n).\nAlthough some studies demonstrated that undigested lactose and SCFAs induce diarrhea secondary to osmotically induced accumulation of ions and water in the colon (\nChristopher and Bayless, 1971\n;\nHammer et al., 1989\n), the change in the large intestinal luminal environment and disorder of the epithelial ion transport mechanism of lactose-induced chronic diarrhea remained unclear. Therefore, the objective of the study was to investigate the effect of an incremental high-lactose diet (IHLD, 30%\/40%\/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbiota and Na\n+\nabsorption.\nMaterials and Methods\nAnimals and Diarrhea Induction Using an Incremental High Lactose Diet\nThe experimental procedures followed the guidelines and practices of the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). The procedures were conducted in accordance with the Beijing Administration Office Committee of Laboratory Animals. Male Wistar rats (350–400 g) were housed under an artificial 12 h light-12 dark cycle (lights on at 08:00 h). Forty rats were fed a standard chow diet\nad libitum\nand had free access to water for 4 days prior to the induction of diarrhea. Then, all rats were randomly divided into 4 groups of 10 animals each. The control group was fed a standard chow diet; the 30% lactose group was fed 30% lactose for 3 weeks; the 40% lactose group was fed 40% lactose for 3 weeks; and the IHLD group was fed 30–40–50% IHLD, which consisted of 30% lactose for the first week, 40% lactose for the second week and 50% lactose for the third week (\nFigure 1\n). An IHLD containing 30, 40, and 50% lactose in place of starch was fed to rats (Keao Xieli Feed Co Ltd., Beijing). Rats were monitored for changes in the consistency of pellets and stool mass and fecal fluid. Rats were considered diarrheic if they produced watery, soft, yellowish stools compared to normal, pliable, soft, well-formed pellets as previously described by other researchers (\nBoakye et al., 2012\n).\nFIGURE 1\nDNA Extraction and PCR Amplification\nCecal microbiota DNA was extracted using the Omega Stool DNA Kit (Qiagen, United States) and applied to amplification of the V3-V4 region of 16S rDNA with the gene-specific primers ACTCCTACGGGAGGCAGCAG and GGACTACHVGGGTWTCTAAT.PCR reactions were performed on a Mastercycler Gradient (Eppendorf, Germany) using 25 μl reaction volumes containing 12.5 μl of 2× Taq Plus Master Mix, 1 μl of forward primer (5 μM), 1 μl of reverse primer (5 μM), 3 μL of BSA (2 ng\/μL), 5 μl of DNA (total template quantity is 30 ng), and 2.5 μl of ddH\n2\nO. PCR amplification was as follows: initiation at 94°C for 5 min, followed by 28 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, with a final extension of 72°C for 7 min. Three PCR products per sample were pooled to mitigate reaction-level PCR biases. The PCR products were purified using a QIAquick Gel Extraction Kit (QIAGEN, Germany), quantified using Real Time PCR, and sequenced at Allwegene Company, Beijing.\nHigh-Throughput Sequencing\nDeep sequencing was performed on the MiSeq platform at Allwegene Company (Beijing). After the run, image analysis, base calling and error estimation were performed using Illumina Analysis Pipeline Version 2.6.\nData Analyses\nThe raw data were first screened, and sequences were removed from consideration if they were shorter than 200 bp, had a low quality score (≤20), contained ambiguous bases or did not exactly match primer sequences and barcode tags. Qualified reads were separated using the sample-specific barcode sequences and trimmed with Illumina Analysis Pipeline Version 2.6. Then, the dataset was analyzed using QIIME. The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97% (\nEdgar, 2013\n) to generate rarefaction curves and to calculate the richness and diversity indices. The Ribosomal Database Project (RDP) Classifier tool was used to classify all sequences into different taxonomic groups (\nCole et al., 2009\n).\nTo examine the similarity between different samples, clustering analyses and PCA were used based on the OTU information from each sample using R (\nWang et al., 2012\n). The evolution distances between microbial communities from each sample were calculated using the tayc coefficient and represented as an Unweighted Pair Group Method with Arithmetic Mean (UPGMA) clustering tree describing the dissimilarity (1-similarity) between multiple samples (\nJiang et al., 2013\n). A Newick-formatted tree file was generated through this analysis. To compare the membership and structure of communities in different samples, heat maps were generated with the top 20 OTUs using Mothur (\nJami et al., 2013\n).\nSCFA, Lactose, Galactose and Lactic Acid Quantity\nThe cecal contents were simply sampled in sterile tubes. Samples were kept frozen at −80°C until analysis. The samples were removed from the freezer, and 1,200 μL of water was added to each thawed sample. The samples were vortexed for 1 min until the material was homogenized. The SCFA content was determined by gas chromatography. Chromatographic analysis was carried out using an Agilent GC system with a flame ionization detector (FID) (Shimadzu Corp, Kyoto, Japan). Fused silica capillary columns 30 m × 0.25 mm coated with 0.25 μm film thickness were used. Nitrogen was used as the carrier gas. The oven temperature was 250°C, and the FID and injection port were set to 300 and 250°C, respectively. The injected sample volume was 1 μL, and the run time for each analysis was 32 min. The chromatograms and data integration were carried out using a Shimadzu C-R5A Chromatopac. The method was performed according to reference (\nDavid et al., 2014\n).\nLactose, galactose and lactic acid were detected by corresponding assay kits (ELAC-100, EGAL-100 and ECLC-100, respectively, Bioassay Systems, Hayward, CA, United States) according to the instructions. An aliquot of 50 mg of cecal and proximal colon content samples was dissolved in deionized water, vortexed for 20 s and centrifuged at 12,000 ×\ng\nfor 10 min at 4°C. The supernatant was eluted from HLB cartridges and evaporated to dryness under a nitrogen stream. Then, 50 μl of deionized water was added to the tube and redissolved.\nUssing Chamber Experiments\nThe distal colon was cut longitudinally along the mesenteric border. The serosa, muscularis and submucosa layers were stripped away with fine forceps to prepare a mucosa sample. Stripped mucosa was mounted in a modified Ussing Chamber in a tissue holder (Easy Mount Chamber; Physiologic Instruments, San Diego, CA, United States) with an aperture surface area of 0.3 cm\n2\n. Each sample was bathed bilaterally in Krebs-Henseleit solution (KHS). A short-circuit current was measured\nin vitro\nin Ussing chambers. Transepithelial PD was then clamped at 0 mV, and the short-circuit current (\nI\nSC\n) was recorded with a VCCMC6 voltage-current clamp amplifier (Physiologic Instruments, San Diego, CA, United States). Transepithelial resistance (TR) (Ω\n∗\ncm\n2\n) was measured by altering the membrane potential in a stepwise fashion (0.1 mV) and calculated from the ohmic relationship.\nSolutions and Chemicals\nKrebs-Henseleit solution (KHS) (mmol\/L): NaCl, 117; KCl, 4.7; MgCl\n2\n, 1.2; KH\n2\nPO\n4\n, 1.2; NaHCO\n3\n, 24.8; CaCl\n2\n, 2.5; and glucose, 11.1. The solution was bubbled with 95% O\n2\nand 5% CO\n2\nto maintain a pH value of 7.4. Na\n+\nfree: NMDGCl 117; KCl 4.7; MgCl\n2\n.6H\n2\nO 1.2; KH\n2\nPO\n3\n1.2; choline HCO\n3\n25; CaCl\n2\n.2H\n2\nO 2.56; GS 11.1.\nThe indomethacin, tetrodotoxin (TTX), DPC, amiloride, and forskolin, were purchased from Sigma (St. Louis, MO, United States). Stock solutions of all the above chemicals were dissolved in DMSO. The final DMSO concentration never exceeded 0.1% (v\/v). Preliminary experiments indicated that the vehicle did not alter any baseline electrophysiological parameters.\nWestern Blotting\nTissue samples were collected from the colon mucosa of the control and high-lactose diets. Tissues were homogenized and sonicated in cold lysis buffer with protein inhibitiors and phosphatase inhibitors (Beyotime Biotechnology, Beijing). After 30 min standing in 4°C, the samples were then centrifuged at 12,000 ×\ng\nfor 30 min at 4°C. The pellets were discarded, and the supernatant was used for blotting. The proteins (50 μg) were separated via 8 or 10% SDS\/PAGE. The blot was washed with Tris-buffered saline containing Tween-20 (TBST) and incubated overnight at 4°C with polyclonal primary antibodies against MCT1, sMCT1, NKCC1, and CFTR (\nSupplementary Table S1\n) and the rabbit polyclonal anti-actin antibody (\nSupplementary Table S1\n). After washing with TBST, the membranes were incubated with secondary antibodies (\nSupplementary Table S1\n).\nImmunostaining\nThe specimens were fixed with 4% paraformaldehyde for 10 min at 25°C, rinsed three times, and incubated with blocking serum for 1 h and anti-MCT, anti-sMCT1, anti-NHE3, anti-NKCC1 and anti-CFTR antibodies overnight at 4°C. After washing with PBS, the specimens were incubated with secondary antibodies. All antibodies in the experiments were shown in the\nSupplementary Material\n(\nSupplementary Table S1\n). Images were obtained using a fluorescence microscope (Leica DM2500, Germany) with 20× or 40× dry lens.\nStatistical Analyses\nAll data are presented as the mean ± SEM. Differences between three groups were evaluated using ANOVA with Prism software (version 9.1, SAS Institute, Inc.), and those between two groups were assessed using the\nt\n-test. The Wilcoxon\nt\n-test was used to compare microbial communities between two groups. Principal component analysis (PCA) plots of bacterial populations were created using Metaboanalyst 3.0. LEfSe analysis of the treatment group was performed on the basis of the results of the Wilcoxon tests, and the threshold on the logarithmic linear discriminant analysis (LDA) score was 3. Significance was defined as\nP\n< 0.05.\nResults\nEffect of IHLD-Induced Diarrhea on the Fecal Form, Fecal Fluid Content and Weight\nAfter 30% lactose administration for 48 h, we observed that the majority of rats began to produce wet, loose and yellowish stools. On the 7th day and 14th day, we changed to 40 and 50% lactose and found profuse, watery stools visibly containing lots of mucus with or without a structural pellet form (\nTable 1\n). Compared to 30% lactose for 3 weeks, the graded increase in the concentration of lactose avoided the adaptation of rats to lactose and exhibited considerably more diarrhea than the same concentration of 30% lactose for 3 weeks. From our data, IHLD-fed rats could induce persistent and chronic diarrhea compared with only 30 or 40% lactose for 3 weeks, which can avoid adaptation to lactose in rats (\nTable 1\n). In the first week, the majority of diarrheic rats (80 and 90%) showed severe diarrhea with profuse, watery stools containing mucus after 30 and 40% lactose diet. In the 3rd week, the fecal characteristics of most rats in the 30 or 40% lactose group showed loose and soft stool pellets, suggesting that diarrhea began to improve. 20% of rats in the IHLD group produced profuse, loose, wet and mucoid stools, and 40% of rats in the IHLD group produced many loose, yellowish, wet stools with or without the structural form of pellets.\nTABLE 1\nDiets\nForm of stool after 48 h to 21st day\nWatery diarrhea + mucous (incontinence or profuse)\nLoose stools + mucous (non-structural stool)\nLoose stool with structural form of pellet\nSoft formed pellets\nHardened normal pellets\nStandard chow diet\n–\n–\n–\n++\n++++\n30% lactose diet 1st w\n+++\n++\n+\n+\n–\n40% lactose diet 1st w\n++++\n++++\n–\n–\n–\nIHLD 1st w\n+++\n++\n+\n+\n–\n30% lactose diet 2nd w\n–\n+\n+\n+\n–\n40% lactose diet 2nd w\n++\n++\n++\n–\n–\nIHLD 2rd w\n+\n++\n+\n+\n–\n30% lactose diet 3rd w\n+\n–\n++\n++\n+\n40% lactose diet\n–\n+\n++\n+\n–\n3rd w IHLD 3rd w\n+\n+\n++\n+\n–\nComparison of the severity of diarrhea after single high lactose (30 or 40%) or incremental high lactose diet (30%\/40%\/50%) feeding for 3 weeks.\nIHLD: incremental high-lactose diet 1st w: the first week, 2nd w: second week, 3rd w: third week. Qualitative assessment score or classification: – condition not observed, + is the observed once\/day; ++ is the observed twice\/day. +++ is the observed 3–4 times\/day, ++++ is the abundantly observed and +++++ is the almost exclusively observed.\nThe IHLD caused a significant increase in fecal fluid content, as fluid content constituted 79% of stool mass compared with 16% in pellets produced by rats fed the standard diet (\nFigure 2A\n;\nP\n< 0.001). Furthermore, IHLD significantly decreased the fecal pH value compared with that of control rats (\nFigure 2B\n,\nP\n< 0.001). In addition, an IHLD significantly decreased weight (\nFigure 2C\n), similar to previous studies (\nLiuzzi and Hevia, 1998\n;\nBoakye et al., 2012\n). The everyday average food consumption and water intake were mildly decreased compared to those of the control group (\nFigures 2D,E\n). The average urine volume were almost same among the four groups (\nFigure 2F\n).\nFIGURE 2\nMicrobial Dysbiosis After Incremental High-Lactose Diet\nIncremental high-lactose diet induced significant alterations in the composition of the luminal microbiota of the cecum by 16S rRNA-Amplicon sequencing. A total of 14 samples from the two groups were analyzed by high-throughput pyrosequencing, which generated 1,133,201 clean tags. After IHLD, the Shannon and Chao 1 indexes revealed that the diversity and richness of the microbial communities were significantly lower than those in the control group (\nFigure 3A\n). Briefly, the results of PCA (Principal component analysis) showed that the composition of the luminal microbiota of IHLD formed a totally different cluster in the ordination plot, suggesting that IHLD caused major changes in the gut microbiome profiles (\nFigure 3B\n).\nFIGURE 3\nUnivariate analysis (LDA effect size) was performed to identify the key phyla and genera that exhibited large alterations in microbial composition after IHLD (\nFigure 4A\n). At the phylum level, the abundance of Bacteroidetes (16.54% versus 0.029%) and Verrucomicrobia (1.01% versus 0.0036%) significantly decreased, whereas that of Proteobacteria significantly increased after IHLD (0.58% versus 6.28%) (\nFigure 4B\nand\nSupplementary Table S2\n). At the genus level, the abundance of 139 genera showed significant differences between the two groups. The IHLD group showed a marked increase compared to the control group in the relative abundances of Bifidobacterium (0.004% versus 1.12%), Escherichia-Shigella (0.02% versus 5.7%), Megamonas (0.23% versus 20.33%), and Lactobacillus (21.85% versus 70.85%) (\nFigure 4B\nand\nSupplementary Table S2\n). In contrast, the concentrations of 59 genera were decreased to zero in the IHLD group, as shown in the\nSupplementary Table S2\n, including SCFA-producing bacteria such as Ruminococcaceae UCG-013 (\nFigure 4C\n), Lachnospiraceae UCG-001 and Lachnospiraceae FCS020 group, also including lactose-fermenting Roseburia species increased by administration of a highly purified short-chain galactooligosaccharide (GOS) (\nAzcarate-Peril et al., 2017\n).\nFIGURE 4\nCorrelation analyses were performed to identify the relationships between microbial genera and lactose fermentation products including lactose, galactose, lactate and SCFAs. The results showed the relative abundances of four genera, including Lactobacillus, Bifidobacterium, Megamonas and Escherichia Shigella, showing a strong relationship with lactose, galactose and lactate (\nFigure 5\n). Among them, the relative abundance of lactobacilli, as the best-known lactic acid-producing bacteria, was 3.3-fold higher in IHLD than in the control. Another 16 genera, especially Allobaculum, Akkermansia, Lactobacillus, Bifidobacterium, and Bacteroides, with very low relative abundances showed a close association with the concentration of SCFAs.\nFIGURE 5\nSCFA, Lactose, Galactose and Lactic Acid Quantification in the Cecal Luminal Contents\nThe SCFA concentration is high in the cecum and proximal colon since SCFAs are produced by microbial fermentation in the cecum (\nTan et al., 2014\n;\nKuwahara et al., 2018\n). Therefore, we investigated the concentration of SCFAs in the cecum. Lactose, galactose, lactic acid and SCFAs were quantified in cecal contents in the control and model groups. Interestingly, a significant decrease in the concentration of SCFAs was observed in the intestinal contents in the IHLD group in contrast to the control group. Acetate, propionate and butyrate were 140% lower in the cecum in the model group than in the control group, as presented in\nFigures 6A,B\n, suggesting that SCFA production was lower in the colon. In contrast, lactose, galactose and lactic acid concentrations were 10-, 6-, and 15-fold higher in the IHLD group, respectively than in the control group (\nFigure 6C\n). The results suggested that the high concentrations of lactose, lactic acid and galactose in the colon lumen but not SCFAs led to hyperosmosis in the colon, which would be the major reason for diarrhea.\nFIGURE 6\nExpression and Location of MCT and sMCT1 in the Colon of the IHLD Group and Control Group\nMCT1 is an H\n+\n-coupled transporter expressed in the apical membrane and basolateral membrane of the colonic epithelium (\nRitzhaupt et al., 1998\n;\nKirat et al., 2009\n), mediating SCFA influx from the lumen and SCFA efflux into the blood (\nIwanaga et al., 2006\n). The western blot results showed that the expression level of MCT1 protein in the colon of the IHLD group was lower by 65% than that in the control group (\nFigures 7A,B\n). Moreover, the number and intensity of MCT1 immunopositive cells were greatly decreased in lactose-fed rats (\nFigures 7E,F\n) compared with control animals (\nFigures 7C,D\n), confirming the western blot results.\nFIGURE 7\nsMCT1 is a Na\n+\n-coupled transporter expressed solely on the apical membrane of the colonic epithelium that mediates SCFA influx from the lumen (\nRitzhaupt et al., 1998\n;\nKuwahara et al., 2018\n). The western blot results showed that the expression level of sMCT1 did not change in IHLD rats compared to the control rats, as shown in\nFigure 7A\n, consistent with the immunofluorescence results (\nFigures 7G,H\n).\nInvolvement of Na\n+\nAbsorption and Anion Secretion in the Colon of the IHLD-Induced Diarrhea Group\nIn order to investigate the basal and stimulated ion transport in the colonic epithelium of the IHLD group, a Ussing Chamber experiment was performed. In short circuit current recording, the basal current represents a summation of all ionic currents across the epithelium (\nXue et al., 2007\n;\nClarke, 2009\n). The basal\nI\nSC\nwas lower in the IHLD-model group (IHLD: 48 ± 5.15 μA\/cm\n2\nversus control: 108 ± 37.23 μA\/cm\n2\n,\nn\n= 10,\nFigure 7A\n). In apical Na\n+\n-free KHS, the basal\nI\nSC\nwithout apical Na\n+\nabsorption in the colonic mucosa of the control group was similar to that of the IHLD group (IHDL: −86.42 ± 7.8 μA\/cm\n2\nversus control: −89.69 ± 11.41 μA\/cm\n2\n,\nn\n= 11). However, the Δbasal\nI\nSC\n(subtract the basal\nI\nSC\nin apical Na\n+\n-free KHS from the basal\nI\nSC\nin normal KHS) in the colonic mucosa of the IHLD group was significantly decreased (IHLD 134.4 ± 2.65 μA\/cm\n2\nversus control: 197.8 ± 25.82 μA\/cm\n2\n,\nn\n= 10,\nFigure 7A\n), suggesting that Na\n+\nabsorption was lower in the IHLD group. After apical treatment with the ENaC inhibitor amiloride, a similar inhibition of basal\nI\nSC\nwas observed in the control and IHLD groups, excluding the ENaC involved in the ion transport of the IHLD group (IHLD: −6.54 ± 1.73 μA\/cm\n2\nversus control: −6.98 ± 2.22 μA\/cm\n2\n,\nSupplementary Figure S1\n). As\nFigure 8\nshown, the results of western blotting and immunostaining showed that the level of total protein expression and phosphorylation of NHE3 protein-mediated Na\n+\nabsorption in the colon were downregulated by 37 and 67% respectively, in the model group compared with the control group (\nFigures 8B–G\n), which was responsible for the low Na\n+\nabsorption.\nFIGURE 8\nFurthermore, the cAMP elevator forskolin (1 μM, basolateral)-induced\nI\nSC\nincrease in the colon of the IHLD group was lower than that in the control group (IHLD: 128.3 ± 15.3 μA\/cm\n2\nversus control: 201.4 ± 28.31 μA\/cm\n2\n,\nFigure 9A\n). The inhibition of basal\nI\nSC\ninduced by apical treatment with a known CFTR inhibitor DPC (diphenylamine-2, 2′-dicarboxylic acid), was significantly higher in the control group than in the IHLD group, suggesting that CFTR-mediated Cl\n–\nsecretion under basal conditions was decreased in the IHLD group compared with the control group (IHLD: −1.12 ± 1.74 μA\/cm\n2\nversus control: −8.10 ± 2.14 μA\/cm\n2\n,\nSupplementary Figure S1\n). The western blot and immunostaining results showed that the protein expression levels of NKCC1 and CFTR in the colonic mucosa were decrease by 50 and 24%,respectively, than those in the control group, contributing to the lower basal and stimulated ion secretion in the model group (\nFigures 9B–G\n).\nFIGURE 9\nDiscussion\nLactose intolerance (LI) appears to be mainly associated with unabsorbed lactose in the small intestine passing into the colon and being metabolized by colonic bacteria to organic acids, including lactic acid and short-chain fatty acids. The organic acids escaping absorption by the colon remain in the colonic lumen and lead to osmotic diarrhea. Previous studies have shown that lactose-induced diarrhea results, in large part, from the combination of net fluid secretion by the stomach and small intestine and interference with net fluid absorption in the colon (\nChristopher and Bayless, 1971\n;\nHammer et al., 1989\n).\nIn our study, we established a chronic diarrhea model using lactose with a gradual increase in concentration for 3 weeks to investigate the mechanism of high lactose-induced diarrhea on organic acid production and ion transport of the colonic epithelium and NHE3, CFTR and NKCC1 expression combined with epithelial locations, which are associated with Na\n+\nabsorption and Cl\n–\nsecretion.\nThe concentrations of lactose, galactose and lactic acid in the cecum in the IHLD model group were higher than those in the control group, but the concentration of SCFAs was lower, suggesting that the major reason for hyperosmosis is due to high concentrations of lactose, galactose and lactic acid in the intestinal lumen, which could cause osmotic diarrhea. Furthermore, the concentration of lactic acid in the cecum content was much higher than that in the control group, which was responsible for the low pH in the feces. Adult rats, as mammals, have intestinal lactase activity that decreases quickly upon weaning, and research has shown that although residual lactase activity is present in adult rats, a high-lactose diet is poorly digested by adult rats (\nAlexandre et al., 2013\n;\nvan de Heijning et al., 2015\n). The increase in galactose in the cecum contents after chronic feeding with high lactose might be due to microbiota fermentation. As expected, our results showed that significant differences were observed in the composition of cecum microbiota via high-throughput MiSeq sequencing after IHLD. A previous study (\nFrancavilla et al., 2012\n) investigated the influence of lactose on the composition of the gut microbiota and the SCFAs of infants with cow’s milk allergy. Similar to our findings, lactose intake can induce an increase in Bifidobacteria and Lactobacilli and a decrease in the numbers of Bacteroides, Prevotella and Clostridia. In addition, we also found that the increased abundances of another two genera, Escherichia-shigella and Megamonas, were positively related to the concentrations of lactose, galactose and lactic acid and might be responsible for the IHLD-induced diarrhea. They also measured SCFA levels and found that the concentration of SCFA increased after addition of lactose, which was the opposite result of our study because of the differences between from infants and adults. In addition, we found the loss of important SCFA-producing microbes, such as lachnospiraceae NK4A136 group and ruminococcaceae UCG-005, after IHLD, which might lead to the lower concentration of luminal SCFAs, consistent with a recent study on a high-sugar diet (\nLaffin et al., 2019\n). Another recent study (\nKamphuis et al., 2019\n) showed that oral gavage with lactose at a modest dose of 5 mg\/day for 3 weeks did not induce alterations in the fecal microbiota of mice, which was different from our study because of the low dose of lactose without significant malabsorption.\nIn our results, we found that the concentrations of SCFAs in the cecal contents of the model group was significantly decreased compared with that of the control group, which was different from a previous study that showed that an increase in SCFAs resulted in acute ingestion of lactose\nin vivo\nand\nin vitro\n(\nHe et al., 2006\n;\nWindey et al., 2015\n). Few studies have focused on the effect of chronic lactose intervention on SCFAs, and a recent study (\nZhai et al., 2018\n) found no significant difference in the SCFA concentration of feces after 3 weeks of lactulose intervention in mice, suggesting a different mechanism between acute and chronic ingestion. In the colon, SCFAs are absorbed by MCT1 and sMCT1 in the colon epithelium. Our results showed that an unaltered expression level and differential distribution of sMCT1 were observed between the control group and IHLD group. However, MCT1 expression was significantly decreased, showing that its low expression level might be caused by lower SCFAs in the lumen, which is also reported to be regulated by butyrate (\nBorthakur et al., 2008\n,\n2012\n).\nCurrently, there is growing evidence indicating that SCFAs are a product of bacterial fermentation involved in the regulation of ion transport (\nYajima et al., 2011\n;\nTan et al., 2014\n;\nKuwahara et al., 2018\n). Previous studies demonstrated that luminal addition of propionate stimulates chloride secretion, which function as a lubricant for the movement of luminal contents in the colon (\nYajima et al., 2011\n). It has been reported that NHE3 mediates Na\n+\nabsorption in the colon, and our data showed that its expression and phosphorylation level were significantly decreased in the model group, confirming a decrease in Na\n+\nabsorption. The results of the Ussing Chamber demonstrated that when apical Na\n+\nwas removed, the delta basal\nI\nSC\nin the IHLD group was significantly decreased, suggesting that Na\n+\nabsorption was involved in the basal current. It is generally accepted that the absorption of Na\n+\nand Cl\n–\nin the colon is mutually interdependent, electrically neutral by largely apical Na\/H exchange and Cl\/HCO\n3\nexchange processes, primarily involving the Na\/H exchanger NHE3 and the Cl\/HCO\n3\nexchanger (\nWalker et al., 2008\n). The evidence from the present study showed that Na\n+\nabsorption and NHE3 protein expression and phosphorylation were decreased in IHLD rats compared with control rats, but the RNA level of NHE3 and the change in the expression of the Cl\/HCO\n3\nexchanger involving Cl\n–\nabsorption still need to be investigated. To the best of our knowledge, no previous report has found that NHE3 is involved in lactose-induced diarrhea and might be a novel target for the attenuation of lactose-induced diarrhea.\nIn this study, we used the chronic diarrhea model induced by giving high lactose for 3 weeks, which could employ a compensatory mechanism to adapt to the diarrhea situation. A previous study showed that rats adapted to a lactose diet and that the size of the cecum returned to normal, but its mechanisms are not clear (\nLawrence et al., 1956\n;\nSzilagyi, 2015\n). Our results showed that basal current and FSK-induced Cl\n–\nsecretion in the model group were lower than those in the control group, which can result in lower luminal anionic secretion and associated luminal transport of water. Furthermore, the NKCC1 and CFTR expression levels in the colon mucosa in the model group decreased compared with those in the control group, resulting in a decrease in basal and FSK-induced\nI\nSC\n. We considered it to have resulted from the compensatory mechanism. In the duodenum, luminal SCFAs induced HCO\n3\n-\nsecretion (\nAkiba et al., 2015\n). Our study showed that lower luminal SCFAs decrease Cl\n–\nsecretion, but the mechanism should be investigated further.\nTaken together, IHLD feeding to rats caused a persistent state of diarrhea, and the cecum tripled in size. The concentrations of lactose, galactose and lactic acid were markedly increased in the cecal luminal contents, contributing to lactose intolerance-induced high osmosis diarrhea. Meanwhile, the lumen SCFA concentration of the cecal contents was significantly decreased. This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and an increase in the relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. In addition, the microbiota diversity in the colon was found to be lower in the cecum of IHLD rats compared with control rats. Concomitantly, the expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels in the colonic mucosa of the IHLD group contributed to the Na\n+\nabsorption and accumulation decrease in the lumen, and the stimulated Cl\n–\nsecretion decrease would be a compensatory effect for water and electrolyte loss during the diarrhea process (\nFigure 10\n). The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbita and Na\n+\nabsorption.\nFIGURE 10\nStatements\nEthics statement\nThe animal study was reviewed and approved by the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2).\nAuthor contributions\nHX, FW, and XT conceived the study. HX designed the experiment, wrote the manuscript, and performed the western blotting and immunostaining. MZ and JM made the animal models and performed the Ussing Chamber experiments. HX quantified SCFAs. HX and TC analyzed the data. FW and XT supervised the research. All authors contributed to the article and approved the submitted version.\nFunding\nThis work was supported by the National Natural Science Foundation of China (Grant No. 81973838) and National Key Research and Development Project (Grant No. 2016YFC1302203).\nAcknowledgments\nThe authors thank Prof. Wang Jiannong and Dr. Sun Caixia for their help for technical support on GC analyses for measuring SCFA levels.\nConflict of interest\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\nSupplementary material\nThe Supplementary Material for this article can be found online at:\nhttps:\/\/www.frontiersin.org\/articles\/10.3389\/fphys.2020.00877\/full#supplementary-material\nFIGURE S1\nComparison of effect of DPC or amiloride on the basal\nI\nSC\ncurrent between control and IHLD group. Values are means ± SEM;\nP\n< 0.05.\nTABLE S1\nAntibodies for western and immunofluorescence.\nTABLE S2\nInformation of statistical test analysis of phylum and genus level between control and IHLD group.\nReferences\n1\nAkiba\nY.\nInoue\nT.\nKaji\nI.\nNarimatsu\nK.\nIwamoto\nK.\net al\n(2015). Short-chain fatty acid sensing in rat duodenum.\nJ. Physiol.\n593585–599. 10.1113\/jphysiol.2014.280792\nPubmed Abstract\nCrossRef\nGoogle Scholar\n2\nAlexandre\nV.\nEven\nP. C.\nLarue\nA. C.\nBlouin\nJ. M.\nBlachier\nF.\nBenamouzig\nR.\net al\n(2013). Lactose malabsorption and colonic fermentations alter host metabolism in rats.\nBr. J. Nutr.\n110625–631. 10.1017\/S0007114512005557\nPubmed Abstract\nCrossRef\nGoogle Scholar\n3\nAzcarate-Peril\nM. A.\nRitter\nA. J.\nSavaiano\nD.\nMonteagudo-Mera\nA.\nAnderson\nC.\nMagness\nS. T.\n(2017). Impact of the short-chain galactooligosaccharides on the gut microbiome of lactose-intolerant individuals.\nProc. Natl. Acad. Sci. U.S.A.\n114E367–E375. 10.1073\/pnas.1606722113\nPubmed Abstract\nCrossRef\nGoogle Scholar\n4\nBayless\nT. M.\nBrown\nE.\nPaige\nD. M.\n(2017). Lactase Non-persistence and Lactose Intolerance.\nCurr. Gastroenterol. Rep\n19:23. 10.1007\/s11894-017-0558-9\nPubmed Abstract\nCrossRef\nGoogle Scholar\n5\nBinder\nH. J.\n(2010). Role of Colonic Short-chain fatty acid transport in diarrhea.\nAnnu. Rev. Physiol\n.\n72297–313. 10.1146\/annurev-physiol-021909-135817\nPubmed Abstract\nCrossRef\nGoogle Scholar\n6\nBinder\nH. J.\nFoster\nE. S.\nBudinger\nM. E.\nHayslett\nJ. P.\n(1987). Mechanism of electroneutral sodium chloride absorption in distal colon of the rat.\nGastroenterology\n93449–455. 10.1016\/0016-5085(87)90905-x\nCrossRef\nGoogle Scholar\n7\nBinder\nH. J.\nSandle\nG. I.\nRajendran\nV. M.\n(1991). “Colonic fluid and electrolyte transport in health and disease,” in\nThe Large Intestine: Physiology, Pathophysiology, and Disease\n, eds\nPhillips\nS. F.\nPemberton\nJ. H.\nShorter\nR. G.\n(New York, NY: Raven Press), 141–168.\nGoogle Scholar\n8\nBoakye\nP. A.\nBrierley\nS. M.\nBalemba\nO. B.\n(2012). Garcinia buchananii bark extract is an effective anti-diarrheal remedy for lactose-induced diarrhea.\nJ. Ethnopharmacol.\n142539–547. 10.1016\/j.jep.2012.05.034\nPubmed Abstract\nCrossRef\nGoogle Scholar\n9\nBorthakur\nA.\nPriyamvada\nS.\nKumar\nA.\nNatarajan\nA. A.\nGill\nR. K.\nAlrefai\nW. A.\net al\n(2012). A novel nutrient sensing mechanism underlies substrate-induced regulation of monocarboxylate transporter 1.\nAm. J. Physiol. Gastrointest. Liver. Physiol.\n303G1126–G1133. 10.1152\/ajpgi.00308.2012\nPubmed Abstract\nCrossRef\nGoogle Scholar\n10\nBorthakur\nA.\nSaksena\nS.\nGill\nR. K.\nAlrefai\nW. A.\nRamaswamy\nK.\nDudeja\nP. K.\n(2008). Regulation of monocarboxylate transporter 1 (MCT1) promoter by butyrate in human intestinal epithelial cells: Involvement of NF-κB pathway.\nJ. Cell. Biochem.\n1031452–1463. 10.1002\/jcb.21532\nPubmed Abstract\nCrossRef\nGoogle Scholar\n11\nBryce\nJ.\nBoschi\nP. C.\nShibuya\nK.\nBlack\nR. E.\n(2005). WHO estimates of the causes of death in children.\nLancet\n3651147–1152. 10.1016\/S0140-6736(05)71877-8\nCrossRef\nGoogle Scholar\n12\nChristopher\nN. L.\nBayless\nT. M.\n(1971). Role of the small bowel and colon in lactose-induced diarrhea.\nGastroenterology\n60845–852. 10.1016\/s0016-5085(71)80083-5\nCrossRef\nGoogle Scholar\n13\nClarke\nL. L.\n(2009). A guide to Ussing chamber studies of mouse intestine.\nAm. J. Physiol. Gastrointest. Liver. Physiol.\n296G1151–G1166. 10.1152\/ajpgi.90649.2008\nPubmed Abstract\nCrossRef\nGoogle Scholar\n14\nCole\nJ. R.\nWang\nQ. E.\nCardenas\nJ.\nFish\nB.\nChai\nR. J.\nFarris\nA. S.\net al\n(2009). The ribosomal database project: improved alignments and new tools for rRNA analysis.\nNucleic Acids Res.\n37D141–D145. 10.1093\/nar\/gkn879\nPubmed Abstract\nCrossRef\nGoogle Scholar\n15\nDavid\nL. A.\nMaurice\nC. F.\nButton\nJ. E.\nWolfe\nB. E.\net al\n(2014). Diet rapidly and reproducibly alters the human gut microbiome.\nNature\n505559–563. 10.1038\/nature12820\nPubmed Abstract\nCrossRef\nGoogle Scholar\n16\nEdgar\nR. C.\n(2013). UPARSE: Highly accurate OTU sequences from microbial amplicon reads.\nNat Methods\n10996–998. 10.1038\/nmeth.2604\nPubmed Abstract\nCrossRef\nGoogle Scholar\n17\nFassio\nF.\nFacioni\nM. S.\nGuagnini\nF.\n(2018). Lactose maldigestion, malabsorption, and intolerance: a comprehensive review with focus on current management and future perspectives.\nNutrients\n10:1599. 10.3390\/nu10111599\nPubmed Abstract\nCrossRef\nGoogle Scholar\n18\nFrancavilla\nR.\nCalasso\nM.\nCalace\nL.\nSiragusa\nS.\nNdagijimana\nM.\nVernocchi\nP.\net al\n(2012). Effect of lactose on gut microbiota and metabolome of infants with cow’s milk allergy.\nPediatr. Allergy Immunol.\n3420–427. 10.1111\/j.1399-3038.2012.01286.x\nPubmed Abstract\nCrossRef\nGoogle Scholar\n19\nGanapathy\nV.\nGopal\nE.\nMiyauchi\nS.\nPrasad\nP. D.\n(2005). Biological functions of SLC5A8,candidate tumour suppressor.\nBiochem. Soc. Trans.\n33(Pt 1)237–240. 10.1042\/BST0330237\nPubmed Abstract\nCrossRef\nGoogle Scholar\n20\nHammer\nH. F.\nHammer\nJ.\n(2012). Diarrhea caused by carbohydrate malabsorption.\nGastroenterol. Clin. N. Am.\n41611–627. 10.1016\/j.gtc.2012.06.003\nPubmed Abstract\nCrossRef\nGoogle Scholar\n21\nHammer\nH. F.\nSanta Ana\nC. A.\nSchiller\nL. R.\nFordtran\nJ. S.\n(1989). Studies of osmotic diarrhea induced in normal subjects by ingestion of polyethylene glycol and lactulose.\nJ. Clin. Invest.\n841056–1062. 10.1172\/JCI114267\nPubmed Abstract\nCrossRef\nGoogle Scholar\n22\nHe\nT.\nPriebe\nM. G.\nHarmsen\nH. J.\nStellaard\nF.\nSun\nX.\nWelling\nG. W.\net al\n(2006). Colonic fermentation may play a role in lactose intolerance in humans.\nJ. Nutr.\n13658–63. 10.1093\/jn\/136.1.58\nPubmed Abstract\nCrossRef\nGoogle Scholar\n23\nHoque\nK. M.\nChakraborty\nS.\nSheikh\nI. A.\nWoodward\nO. M.\n(2012). New advances in the pathophysiology of intestinal ion transport and barrier function in diarrhea and the impact on therapy.\nExpert Rev. Anti Infect. Ther.\n10687–699. 10.1586\/eri.12.47\nPubmed Abstract\nCrossRef\nGoogle Scholar\n24\nIwanaga\nT.\nTakebe\nK.\nKato\nI.\nKaraki\nS.\nKuwahara\nA.\n(2006). Cellular expression of monocarboxylate transporters (MCT) in the digestive tract of the mouse, rat, and humans, with special reference to slc5a8.\nBiomed. Res.\n27243–254. 10.2220\/biomedres.27.243\nPubmed Abstract\nCrossRef\nGoogle Scholar\n25\nJami\nE.\nIsrael\nA.\nKotser\nA.\nMizrahi\nI.\n(2013). Exploring the bovine rumen bacterial community from birth to adulthood.\nISME J\n.\n71069–1079. 10.1038\/ismej.2013.2\nPubmed Abstract\nCrossRef\nGoogle Scholar\n26\nJiang\nX. T.\nPeng\nX.\nDeng\nG. H.\nSheng\nH. F.\nWang\nY.\nZhou\nH. W.\n(2013). Illumina sequencing of 16S rRNA Tag revealed spatial variations of bacterial communities in a mangrove wetland.\nMicrob. Ecol.\n6696–104. 10.1007\/s00248-013-0238-8\nPubmed Abstract\nCrossRef\nGoogle Scholar\n27\nKaji\nI.\nAkiba\nY.\nKonno\nK.\nWatanabe\nM.\nKimura\nS.\nIwanaga\nT.\n(2016). Neural FFA3 activation inversely regulates anion secretion evoked by nicotinic ACh receptor activation in rat.\nJ. Physiol.\n5943339–3352. 10.1113\/JP271441\nPubmed Abstract\nCrossRef\nGoogle Scholar\n28\nKamphuis\nJ. B. J.\nGuiard\nB.\nLeveque\nM.\nOlier\nM.\nJouanin\nI.\nYvon\nS.\net al\n(2019). Lactose and fructo-ligosaccharides increase visceral sensitivity in mice via glycation processes, increasing mast cell density in colonic mucosa.\nGastroenterology\n158652–663.e6. 10.1053\/j.gastro.2019.10.037652663e6\nCrossRef\nGoogle Scholar\n29\nKirat\nD.\nKondo\nK.\nShimada\nR.\nKato\nS.\n(2009). Dietary pectin up-regulates monocaboxylate transporter1 in the rat gastrointestinal tract.\nExp. Physiol.\n94422–433. 10.1113\/expphysiol.2009.046797\nPubmed Abstract\nCrossRef\nGoogle Scholar\n30\nKunzelmann\nK.\nMall\nM.\n(2002). Electrolyte transport in the mammalian colon: mechanisms and implications for disease.\nPhysiol Rev.\n82245–289. 10.1152\/physrev.00026.2001\nPubmed Abstract\nCrossRef\nGoogle Scholar\n31\nKuwahara\nA.\nKuwahara\nY.\nInui\nT.\nMarunaka\nY.\n(2018). Regulation of ion transport in the intestine by free fatty acid receptor 2 and 3: possible involvement of the diffuse chemosensory system.\nInt. J. Mol. Sci.\n19:735. 10.3390\/ijms19030735\nPubmed Abstract\nCrossRef\nGoogle Scholar\n32\nLaffin\nM.\nFedorak\nR.\nZalasky\nA.\nPark\nH.\nGill\nA.\nAgrawal\nA.\n(2019). A high-sugar diet rapidly enhances susceptibility to colitis via depletion of luminal short-chainfatty acids in mice.\nSci. Rep.\n9:12294. 10.1038\/s41598-019-48749-2\nPubmed Abstract\nCrossRef\nGoogle Scholar\n33\nLawrence\nJ. V.\nFischer\nJ. E.\nSutton\nT. S.\nWeiser\nH. H.\n(1956). Adaptation of the rat to a higher lactose diet, effect of the size of the cecum.\nOhio J. Sci.\n5687–92.\nGoogle Scholar\n34\nLiuzzi\nJ. P.\nHevia\nP.\n(1998). In well-fed young rats, lactose-induced chronic diarrhea reduces the apparent absorption of vitamins A and E and affects preferentially vitamin E status.\nJ. Nutr.\n1282467–2472. 10.1093\/jn\/128.12.2467\nPubmed Abstract\nCrossRef\nGoogle Scholar\n35\nMusch\nM. W.\nBookstein\nC.\nXie\nY.\nSellin\nJ. H.\nChang\nE. B.\n(2001). SCFA increase intestinal Na absorption by induction of NHE3 in rat colon and human intestinal C2\/bbe cells.\nAm. J. Physiol. Gastrointest. Liver Physiol.\n280G687–G693. 10.1152\/ajpgi.2001.280.4.G687\nPubmed Abstract\nCrossRef\nGoogle Scholar\n36\nRitzhaupt\nA.\nWood\nI. S.\nEllis\nA.\nHosie\nK. B.\nShirazi-Beechey\nS. P.\n(1998). Identification and characterization of a monocarboxylate transporter (MCT1) in pig and human colon: its potential to transport L-lactate as well as butyrate.\nJ. Physiol.\n513(Pt 3)719–732. 10.1111\/j.1469-7793.1998.719ba.x\nPubmed Abstract\nCrossRef\nGoogle Scholar\n37\nSivaprakasam\nS.\nBhutia\nY. D.\nYang\nS.\nGanapathy\nV.\n(2017). Short-chain fatty acid transporters: role in colonic homeostasis.\nCompr. Physiol.\n8299–314. 10.1002\/cphy.c170014\nPubmed Abstract\nCrossRef\nGoogle Scholar\n38\nSubramanya\nS. B.\nRajendran\nV. M.\nSrinivasan\nP.\nNanda\nK. N. S.\nBinder\nH. J.\n(2007). Differential regulation of cholera toxin-inhibited Na-H exchange isoforms by butyrate in rat ileum.\nAm. J. Physiol. Gastrointest. Liver. Physiol.\n293G857–G863. 10.1152\/ajpgi.00462.2006\nPubmed Abstract\nCrossRef\nGoogle Scholar\n39\nSwagerty\nD. L.\nJr.\nWalling\nA. D.\nKlein\nR. M.\n(2002). Lactose intolerance.\nAm. Fam. Physician.\n651845–1850.\nGoogle Scholar\n40\nSzilagyi\nA.\n(2015). Adaptation to lactose in lactase non persistent people: Effects on intolerance and the relationship between Dairy Food consumption and evalution of diseases.\nNutrients\n76751–6779. 10.3390\/nu7085309\nPubmed Abstract\nCrossRef\nGoogle Scholar\n41\nTan\nJ.\nMcKenzie\nC.\nPotamitis\nM.\nThorburn\nA. N.\nMackay\nC. R.\nMacia\nL.\n(2014). The role of short-chain fatty acids in health and disease.\nAdv. Immunol.\n12191–119. 10.1016\/B978-0-12-800100-4.00003-9\nPubmed Abstract\nCrossRef\nGoogle Scholar\n42\nThapar\nN.\nSanderson\nI. R.\n(2004). Diarrhoea in children: an interface between developing and developed countries.\nLancet\n363641–653. 10.1016\/S0140-6736(04)15599-2\nCrossRef\nGoogle Scholar\n43\nvan de Heijning\nB. J.\nSchipper\nL.\nVoogd\nE.\nOosting\nA.\nvan der Beek\nE. M.\n(2015). Acute and chronic effects of dietary lactose in adult rats are not explained by residual intestinal lactase activity.\nNutrients\n75542–5555. 10.3390\/nu7075237\nPubmed Abstract\nCrossRef\nGoogle Scholar\n44\nVidyasagar\nS.\nRamakrishna\nB. S.\n(2002). Effects of butyrate on active sodium and chloride transport in rat and rabbit distal colon.\nJ. Physiol.\n539(Pt 1)163–173. 10.1113\/jphysiol.2001.013056\nPubmed Abstract\nCrossRef\nGoogle Scholar\n45\nWalker\nN. M.\nSimpson\nJ. E.\nYen\nP. F.\nGill\nR. K.\nRigsby\nE. V.\nBrazill\nJ. M.\n(2008). Down-regulated in adenoma Cl\/HCO3 exchanger couples with Na\/H exchanger 3 for NaCl absorptionin murine small intestine.\nGastroenterology\n1351645–1653.\nGoogle Scholar\n46\nWang\nY.\nSheng\nH. F.\nHe\nY.\nWu\nJ. Y.\nJiang\nY. X.\nTam\nN. F.\n(2012). Comparison of the levels of bacterial diversity in fresh water, intertidal wetland, and marine sediments by using millions of Illumina Tags.\nAppl. Environ. Microbiol.\n78:8264. 10.1128\/AEM.01821-12\nPubmed Abstract\nCrossRef\nGoogle Scholar\n47\nWardlaw\nT.\nSalama\nP.\nBrocklehurst\nC.\nChopra\nM.\nMason\nE.\n(2010). Diarrhoea: why children are still dying and what can be done.\nLancet\n375870–872. 10.1016\/S0140-6736(09)61798-0\nCrossRef\nGoogle Scholar\n48\nWindey\nK.\nHouben\nE.\nDeroover\nL.\nVerbeke\nK.\n(2015). Contribution of colonic fermentation and fecal water toxicity to the pathophysiology of lactose-intolerance.\nNutrients\n77505–7522. 10.3390\/nu7095349\nPubmed Abstract\nCrossRef\nGoogle Scholar\n49\nXue\nH.\nTian\nY. M.\nYan\nM.\nYang\nN.\nXing\nY.\net al\n(2007). Appearance of segmental discrepancy of anion transport in rat distal colon.\nBiol. Pharm. Bull.\n301407–1411. 10.1248\/bpb.30.1407\nPubmed Abstract\nCrossRef\nGoogle Scholar\n50\nYajima\nT.\nInoue\nR.\nMatsumoto\nM.\nYajima\nM.\n(2011). Non-neuronal release of ACh plays a key role in secretory response to luminal propionate in rat colon.\nJ. Physiol.\n589(Pt 4)953–962. 10.1113\/jphysiol.2010.199976\nPubmed Abstract\nCrossRef\nGoogle Scholar\n51\nZhai\nS.\nZhu\nL.\nQin\nS.\nLi\nL.\n(2018). Effect of lactulose intervention on gut microbiota and short chain fatty acid composition of C57BL\/6J mice.\nMicrobiologyopen\n7:e00612. 10.1002\/mbo3.612\nPubmed Abstract\nCrossRef\nGoogle Scholar\nKeywords\nlactose, diarrhea, microbiota, SCFA, Na\n+\nCitation\nXue H, Zhang M, Ma J, Chen T, Wang F and Tang X (2020) Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon.\nFront. Physiol.\n11:877. doi:\n10.3389\/fphys.2020.00877\nReceived\n04 March 2020\nAccepted\n29 June 2020\nPublished\n29 July 2020\nVolume\n11 - 2020\nEdited by\nKusum K. Kharbanda, University of Nebraska Medical Center, United States\nReviewed by\nWaddah Alrefai, University of Illinois at Chicago, United States; Shubha Priyamvada, University of Illinois at Chicago, United States\nUpdates\nCopyright\n© 2020 Xue, Zhang, Ma, Chen, Wang and Tang.\nThis is an open-access article distributed under the terms of the\nCreative Commons Attribution License (CC BY)\n. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\n*\nCorrespondence:\nHong Xue,\nxuehong03@163.com\n; Fengyun Wang,\nwfy811@163.com\n; Xudong Tang,\ntxdly@sina.com.cn\n;\ntxdly@sina.com\nThis article was submitted to Gastrointestinal Sciences, a section of the journal Frontiers in Physiology\nDisclaimer\nAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.","attrs_markdown":"[![]() Frontiers in Physiology](https:\/\/www.frontiersin.org\/journals\/physiology)\n\nAbout us\n\nAbout us\n\n- Who we are\n- [Mission and values](https:\/\/www.frontiersin.org\/about\/mission)\n- [History](https:\/\/www.frontiersin.org\/about\/history)\n- [Leadership](https:\/\/www.frontiersin.org\/about\/leadership)\n- [Awards](https:\/\/www.frontiersin.org\/about\/awards)\n\n- Impact and progress\n- [Frontiers' impact](https:\/\/www.frontiersin.org\/about\/impact)\n- [Our annual reports](https:\/\/www.frontiersin.org\/about\/annual-reports)\n- [Thought leadership](https:\/\/www.frontiersin.org\/about\/thought-leadership)\n\n- Publishing model\n- [How we publish](https:\/\/www.frontiersin.org\/about\/how-we-publish)\n- [Open access](https:\/\/www.frontiersin.org\/about\/open-access)\n- [Peer review](https:\/\/www.frontiersin.org\/about\/peer-review)\n- [Research integrity](https:\/\/www.frontiersin.org\/about\/research-integrity)\n- [Research Topics](https:\/\/www.frontiersin.org\/about\/research-topics)\n- [FAIR² Data Management](https:\/\/www.frontiersin.org\/about\/fair-data-management)\n- [Fee policy](https:\/\/www.frontiersin.org\/about\/fee-policy)\n\n- Services\n- [Societies](https:\/\/publishingpartnerships.frontiersin.org\/)\n- [National consortia](https:\/\/www.frontiersin.org\/open-access-agreements\/consortia)\n- [Institutional partnerships](https:\/\/www.frontiersin.org\/about\/open-access-agreements)\n- [Collaborators](https:\/\/www.frontiersin.org\/about\/collaborators)\n\n- More from Frontiers\n- [Frontiers Forum](https:\/\/forum.frontiersin.org\/)\n- [Frontiers Planet Prize](https:\/\/www.frontiersin.org\/about\/frontiers-planet-prize)\n- [Press office](https:\/\/pressoffice.frontiersin.org\/)\n- [Sustainability](https:\/\/www.frontiersin.org\/about\/sustainability)\n- [Career opportunities](https:\/\/careers.frontiersin.org\/)\n- [Contact us](https:\/\/www.frontiersin.org\/about\/contact)\n\n[All journals](https:\/\/www.frontiersin.org\/journals)[All articles](https:\/\/www.frontiersin.org\/articles)[Submit your research](https:\/\/www.frontiersin.org\/submission\/submit?domainid=1&fieldid=65&specialtyid=0&entitytype=2&entityid=210)\n\n[Search](https:\/\/www.frontiersin.org\/search?tab=top-results&origin=https%3A%2F%2Fwww.frontiersin.org%2Fjournals%2Fphysiology%2Farticles%2F10.3389%2Ffphys.2020.00877%2Ffull)[Login](https:\/\/www.frontiersin.org\/people\/login?returnUrl=https%3A%2F%2Fwww.frontiersin.org%2Fjournals%2Fphysiology%2Farticles%2F10.3389%2Ffphys.2020.00877%2Ffull)\n\n[![]() Frontiers in Physiology](https:\/\/www.frontiersin.org\/journals\/physiology)\n\nSections\n\nSections\n\n- [Aquatic Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/aquatic-physiology)\n- [Autonomic Neuroscience](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/autonomic-neuroscience)\n- [Avian Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/avian-physiology)\n- [Biophysics](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/biophysics)\n- [Cardiac Electrophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/cardiac-electrophysiology)\n- [Cell Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/cell-physiology)\n- [Chronobiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/chronobiology)\n- [Clinical and Translational Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/clinical-and-translational-physiology)\n- [Computational Physiology and Medicine](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/computational-physiology-and-medicine)\n- [Craniofacial Biology and Dental Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/craniofacial-biology-and-dental-research)\n- [Developmental Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/developmental-physiology)\n- [Environmental, Aviation and Space Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/environmental-aviation-and-space-physiology)\n- [Exercise Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/exercise-physiology)\n- [Gastrointestinal Sciences](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/gastrointestinal-sciences)\n- [Integrative Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/integrative-physiology)\n- [Invertebrate Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/invertebrate-physiology)\n- [Lipid and Fatty Acid Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/lipid-and-fatty-acid-research)\n- [Medical Physics and Imaging](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/medical-physics-and-imaging)\n- [Membrane Physiology and Membrane Biophysics](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/membrane-physiology-and-membrane-biophysics)\n- [Metabolic Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/metabolic-physiology)\n- [Mitochondrial Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/mitochondrial-research)\n- [Physio-logging](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/physio-logging)\n- [Red Blood Cell Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/red-blood-cell-physiology)\n- [Redox Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/redox-physiology)\n- [Renal Physiology and Pathophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/renal-physiology-and-pathophysiology)\n- [Reproductive and Mating Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/reproductive-and-mating-physiology)\n- [Respiratory Physiology and Pathophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/respiratory-physiology-and-pathophysiology)\n- [Skeletal Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/skeletal-physiology)\n- [Skin Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/skin-physiology)\n- [Striated Muscle Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/striated-muscle-physiology)\n- [Vascular Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/vascular-physiology)\n\n[Articles](https:\/\/www.frontiersin.org\/journals\/physiology\/articles)[Research Topics](https:\/\/www.frontiersin.org\/journals\/physiology\/research-topics)[Editorial board](https:\/\/www.frontiersin.org\/journals\/physiology\/editors)\n\nAbout journal\n\nAbout journal\n\n- Scope\n- [Field chief editors](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-editors)\n- [Mission & scope](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-scope)\n- [Facts](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-facts)\n- [Journal sections](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-submission)\n- [Open access statement](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-open)\n- [Copyright statement](https:\/\/www.frontiersin.org\/journals\/physiology\/about#copyright-statement)\n- [Quality](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-quality)\n\n- For authors\n- [Why submit?](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/why-submit)\n- [Article types](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/article-types)\n- [Author guidelines](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/author-guidelines)\n- [Editor guidelines](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/editor-guidelines)\n- [Publishing fees](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/publishing-fees)\n- [Submission checklist](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/submission-checklist)\n- [Contact editorial office](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/contact-editorial-office)\n\nAbout us\n\nAbout us\n\n- Who we are\n- [Mission and values](https:\/\/www.frontiersin.org\/about\/mission)\n- [History](https:\/\/www.frontiersin.org\/about\/history)\n- [Leadership](https:\/\/www.frontiersin.org\/about\/leadership)\n- [Awards](https:\/\/www.frontiersin.org\/about\/awards)\n\n- Impact and progress\n- [Frontiers' impact](https:\/\/www.frontiersin.org\/about\/impact)\n- [Our annual reports](https:\/\/www.frontiersin.org\/about\/annual-reports)\n- [Thought leadership](https:\/\/www.frontiersin.org\/about\/thought-leadership)\n\n- Publishing model\n- [How we publish](https:\/\/www.frontiersin.org\/about\/how-we-publish)\n- [Open access](https:\/\/www.frontiersin.org\/about\/open-access)\n- [Peer review](https:\/\/www.frontiersin.org\/about\/peer-review)\n- [Research integrity](https:\/\/www.frontiersin.org\/about\/research-integrity)\n- [Research Topics](https:\/\/www.frontiersin.org\/about\/research-topics)\n- [FAIR² Data Management](https:\/\/www.frontiersin.org\/about\/fair-data-management)\n- [Fee policy](https:\/\/www.frontiersin.org\/about\/fee-policy)\n\n- Services\n- [Societies](https:\/\/publishingpartnerships.frontiersin.org\/)\n- [National consortia](https:\/\/www.frontiersin.org\/open-access-agreements\/consortia)\n- [Institutional partnerships](https:\/\/www.frontiersin.org\/about\/open-access-agreements)\n- [Collaborators](https:\/\/www.frontiersin.org\/about\/collaborators)\n\n- More from Frontiers\n- [Frontiers Forum](https:\/\/forum.frontiersin.org\/)\n- [Frontiers Planet Prize](https:\/\/www.frontiersin.org\/about\/frontiers-planet-prize)\n- [Press office](https:\/\/pressoffice.frontiersin.org\/)\n- [Sustainability](https:\/\/www.frontiersin.org\/about\/sustainability)\n- [Career opportunities](https:\/\/careers.frontiersin.org\/)\n- [Contact us](https:\/\/www.frontiersin.org\/about\/contact)\n\n[All journals](https:\/\/www.frontiersin.org\/journals)[All articles](https:\/\/www.frontiersin.org\/articles)[Submit your research](https:\/\/www.frontiersin.org\/submission\/submit?domainid=1&fieldid=65&specialtyid=0&entitytype=2&entityid=210)\n\n[![]() Frontiers in Physiology](https:\/\/www.frontiersin.org\/journals\/physiology)\n\nSections\n\nSections\n\n- [Aquatic Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/aquatic-physiology)\n- [Autonomic Neuroscience](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/autonomic-neuroscience)\n- [Avian Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/avian-physiology)\n- [Biophysics](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/biophysics)\n- [Cardiac Electrophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/cardiac-electrophysiology)\n- [Cell Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/cell-physiology)\n- [Chronobiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/chronobiology)\n- [Clinical and Translational Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/clinical-and-translational-physiology)\n- [Computational Physiology and Medicine](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/computational-physiology-and-medicine)\n- [Craniofacial Biology and Dental Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/craniofacial-biology-and-dental-research)\n- [Developmental Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/developmental-physiology)\n- [Environmental, Aviation and Space Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/environmental-aviation-and-space-physiology)\n- [Exercise Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/exercise-physiology)\n- [Gastrointestinal Sciences](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/gastrointestinal-sciences)\n- [Integrative Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/integrative-physiology)\n- [Invertebrate Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/invertebrate-physiology)\n- [Lipid and Fatty Acid Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/lipid-and-fatty-acid-research)\n- [Medical Physics and Imaging](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/medical-physics-and-imaging)\n- [Membrane Physiology and Membrane Biophysics](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/membrane-physiology-and-membrane-biophysics)\n- [Metabolic Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/metabolic-physiology)\n- [Mitochondrial Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/mitochondrial-research)\n- [Physio-logging](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/physio-logging)\n- [Red Blood Cell Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/red-blood-cell-physiology)\n- [Redox Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/redox-physiology)\n- [Renal Physiology and Pathophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/renal-physiology-and-pathophysiology)\n- [Reproductive and Mating Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/reproductive-and-mating-physiology)\n- [Respiratory Physiology and Pathophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/respiratory-physiology-and-pathophysiology)\n- [Skeletal Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/skeletal-physiology)\n- [Skin Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/skin-physiology)\n- [Striated Muscle Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/striated-muscle-physiology)\n- [Vascular Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/vascular-physiology)\n\n[Articles](https:\/\/www.frontiersin.org\/journals\/physiology\/articles)[Research Topics](https:\/\/www.frontiersin.org\/journals\/physiology\/research-topics)[Editorial board](https:\/\/www.frontiersin.org\/journals\/physiology\/editors)\n\nAbout journal\n\nAbout journal\n\n- Scope\n- [Field chief editors](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-editors)\n- [Mission & scope](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-scope)\n- [Facts](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-facts)\n- [Journal sections](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-submission)\n- [Open access statement](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-open)\n- [Copyright statement](https:\/\/www.frontiersin.org\/journals\/physiology\/about#copyright-statement)\n- [Quality](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-quality)\n\n- For authors\n- [Why submit?](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/why-submit)\n- [Article types](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/article-types)\n- [Author guidelines](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/author-guidelines)\n- [Editor guidelines](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/editor-guidelines)\n- [Publishing fees](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/publishing-fees)\n- [Submission checklist](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/submission-checklist)\n- [Contact editorial office](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/contact-editorial-office)\n\n[![]() Frontiers in Physiology](https:\/\/www.frontiersin.org\/journals\/physiology)\n\nSections\n\nSections\n\n- [Aquatic Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/aquatic-physiology)\n- [Autonomic Neuroscience](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/autonomic-neuroscience)\n- [Avian Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/avian-physiology)\n- [Biophysics](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/biophysics)\n- [Cardiac Electrophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/cardiac-electrophysiology)\n- [Cell Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/cell-physiology)\n- [Chronobiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/chronobiology)\n- [Clinical and Translational Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/clinical-and-translational-physiology)\n- [Computational Physiology and Medicine](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/computational-physiology-and-medicine)\n- [Craniofacial Biology and Dental Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/craniofacial-biology-and-dental-research)\n- [Developmental Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/developmental-physiology)\n- [Environmental, Aviation and Space Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/environmental-aviation-and-space-physiology)\n- [Exercise Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/exercise-physiology)\n- [Gastrointestinal Sciences](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/gastrointestinal-sciences)\n- [Integrative Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/integrative-physiology)\n- [Invertebrate Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/invertebrate-physiology)\n- [Lipid and Fatty Acid Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/lipid-and-fatty-acid-research)\n- [Medical Physics and Imaging](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/medical-physics-and-imaging)\n- [Membrane Physiology and Membrane Biophysics](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/membrane-physiology-and-membrane-biophysics)\n- [Metabolic Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/metabolic-physiology)\n- [Mitochondrial Research](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/mitochondrial-research)\n- [Physio-logging](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/physio-logging)\n- [Red Blood Cell Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/red-blood-cell-physiology)\n- [Redox Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/redox-physiology)\n- [Renal Physiology and Pathophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/renal-physiology-and-pathophysiology)\n- [Reproductive and Mating Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/reproductive-and-mating-physiology)\n- [Respiratory Physiology and Pathophysiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/respiratory-physiology-and-pathophysiology)\n- [Skeletal Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/skeletal-physiology)\n- [Skin Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/skin-physiology)\n- [Striated Muscle Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/striated-muscle-physiology)\n- [Vascular Physiology](https:\/\/www.frontiersin.org\/journals\/physiology\/sections\/vascular-physiology)\n\n[Articles](https:\/\/www.frontiersin.org\/journals\/physiology\/articles)[Research Topics](https:\/\/www.frontiersin.org\/journals\/physiology\/research-topics)[Editorial board](https:\/\/www.frontiersin.org\/journals\/physiology\/editors)\n\nAbout journal\n\nAbout journal\n\n- Scope\n- [Field chief editors](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-editors)\n- [Mission & scope](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-scope)\n- [Facts](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-facts)\n- [Journal sections](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-submission)\n- [Open access statement](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-open)\n- [Copyright statement](https:\/\/www.frontiersin.org\/journals\/physiology\/about#copyright-statement)\n- [Quality](https:\/\/www.frontiersin.org\/journals\/physiology\/about#about-quality)\n\n- For authors\n- [Why submit?](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/why-submit)\n- [Article types](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/article-types)\n- [Author guidelines](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/author-guidelines)\n- [Editor guidelines](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/editor-guidelines)\n- [Publishing fees](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/publishing-fees)\n- [Submission checklist](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/submission-checklist)\n- [Contact editorial office](https:\/\/www.frontiersin.org\/journals\/physiology\/for-authors\/contact-editorial-office)\n\n[Submit your research](https:\/\/www.frontiersin.org\/submission\/submit?domainid=1&fieldid=65&specialtyid=0&entitytype=2&entityid=210)[Search](https:\/\/www.frontiersin.org\/search?tab=top-results&origin=https%3A%2F%2Fwww.frontiersin.org%2Fjournals%2Fphysiology%2Farticles%2F10.3389%2Ffphys.2020.00877%2Ffull)[Login](https:\/\/www.frontiersin.org\/people\/login?returnUrl=https%3A%2F%2Fwww.frontiersin.org%2Fjournals%2Fphysiology%2Farticles%2F10.3389%2Ffphys.2020.00877%2Ffull)\n\n## ORIGINAL RESEARCH article\nFront. Physiol., 29 July 2020\n\nSec. Gastrointestinal Sciences\n\nVolume 11 - 2020 \\| <https:\/\/doi.org\/10.3389\/fphys.2020.00877>\n\n## ORIGINAL RESEARCH article\nFront. Physiol., 29 July 2020\n\nSec. Gastrointestinal Sciences\n\nVolume 11 - 2020 \\| <https:\/\/doi.org\/10.3389\/fphys.2020.00877>\n# Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon\n- [HXHong Xue \\*](https:\/\/loop.frontiersin.org\/people\/921458)\n- MZ\n  \n  Min Zhang\n- JM\n  \n  Jinxin Ma\n- TC\n  \n  Ting Chen\n- FW\n  \n  Fengyun Wang \\*\n- XT\n  \n  Xudong Tang \\*\n\n- Digestive Laboratory of Traditional Chinese Medicine Research Institute of Spleen and Stomach Diseases, Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing, China\n\nArticle metrics\n\n[View details](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#metrics)\n\n## Abstract\nDiarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the epithelial ion transport in lactose-induced diarrhea remain unclear. The present study aimed to investigate the effect of an incremental high-lactose diet (IHLD, 30%\/40%\/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. Gut microbiota were analyzed by 16S rRNA amplicon sequencing and the concentration of SCFAs by gas chromatography, galactose, lactose and lactic acid through assay kit; Ussing chamber was performed to detect basal and stimulated ion transport; The expression and location of SCFA transporters, the Na-H exchanger 3(NHE3), cystic fibrosis transporter regulater (CFTR) and NKCC1 in the colon mucosa were analyzed by western and immunostaining. The concentrations of lactose, galactose and lactic acid of the cecal content were markedly increased (*P* \\< 0.01) and SCFA concentration was significantly decreased (*P* \\< 0.01). This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and increased relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. The expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels, and decreases in delta basal short circuit current after apical Na\\+ removal in the colonic mucosa of the IHLD group contributed to Na\\+ accumulation in the lumen and decrease stimulated Cl– secretion with low CFTR and NKCC1 expression would compensate for water and electrolyte loss during the diarrhea process. These results indicated that the persistence of the diarrhea state was maintained by abnormal colonic microbiota fermentation leading to high concentrations of lactose, galactose and lactic acid and low SCFAs in the lumen, and decreased Na\\+ absorption with the low NHE3 expression and phosphorylation levels.\n\n## Introduction\nDiarrhea is a highly prevalent and bothersome disorder, particularly in children and the elderly. According to the WHO, it is estimated that 577,000 children aged \\<5 years and 502,000 adults aged \\>70 years will die from diarrheal diseases worldwide ([Thapar and Sanderson, 2004](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B42); [Bryce et al., 2005](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B11); [Wardlaw et al., 2010](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B47)). Long-standing diarrhea causes malnutrition, which in turn leads to more difficulty in treating. Approximately 70% of the world’s population has hypolactasia after weaning, resulting in lactose malabsorption or lactose intolerance, defined as the presence of gastrointestinal symptoms such as bloating, rumbling, abdominal pain, nausea and diarrhea ([Swagerty et al., 2002](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B39); [Bayless et al., 2017](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B4); [Fassio et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B17)).\n\nAs we know, lactose intolerance-induced diarrhea belongs to osmotic diarrhea, thereby resulting in colonic water and electrolyte accumulation ([Hammer and Hammer, 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B20)). It is believed that the osmotic load is not only caused by undigested lactose but that the colonic fermentation capacity plays a role in lactose intolerance ([He et al., 2006](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B22)). Lactose is fermented by the colonic resident microbiota into a series of intermediate and end-product metabolites, including lactate, formate, succinate and short-chain fatty acids (SCFAs), including acetate, propionate and butyrate ([He et al., 2006](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B22); [Windey et al., 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B48)). Some reports have indicated that the osmolality of lactose-induced diarrhea is closely linked to the lactose content and the production of SCFAs in the colon ([Binder, 2010](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B5); [Alexandre et al., 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B2)). SCFAs are the main anions of the colon, which have been demonstrated to be novel regulators of colonic ion transport ([Yajima et al., 2011](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B50); [Kaji et al., 2016](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B27)). Therefore, we speculated that the mechanism of lactose-induced diarrhea involved a change in SCFAs or lactate leading to a disturbance in colonic epithelial ion transport resulting in diarrhea. In the process of the transport of SCFAs, monocarboxylate (MCT1) and sodium MCT1 (sMCT1) transporters play an important role in mediating SCFA influx into the blood from the lumen ([Ritzhaupt et al., 1998](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B36); [Ganapathy et al., 2005](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B19); [Sivaprakasam et al., 2017](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B37)).\n\nIt is commonly recognized that diarrhea results from excessive secretion and\/or impaired absorption of fluid and electrolytes across the intestinal epithelium. Excessive fluid secretion is caused by active chloride secretion into the intestinal lumen, which drives secondary movement of sodium and water ([Binder et al., 1991](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B7); [Hoque et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B23)). Chloride secretion involves the activation of chloride channel(s), such as CFTR, on the apical plasma membrane, and it is transported into the cell at the basolateral membrane by a Na\/K\/Cl symporter (NKCC1, also known as SLC12A2) ([Kunzelmann and Mall, 2002](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B30)). Na\\+ absorption includes electrogenic Na\\+ absorption mediated by epithelial Na\\+ channels (ENaC), whereas electroneutral Na\\+ absorption is mediated by the Na-H exchanger (NHE) and Cl–\\-HCO−3 3 \\- exchanger (an anion exchanger; AE) ([Binder et al., 1987](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B6)). NHE3 mediates both HCO3\\-dependent and butyrate-dependent Na\\+ absorption in the normal gut, which is regulated by butyrate ([Subramanya et al., 2007](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B38)), inducing NHE3 expression and increasing Na\\+ absorption in the rat colon ([Musch et al., 2001](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B35); [Vidyasagar and Ramakrishna, 2002](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B44)).\n\nAlthough some studies demonstrated that undigested lactose and SCFAs induce diarrhea secondary to osmotically induced accumulation of ions and water in the colon ([Christopher and Bayless, 1971](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B12); [Hammer et al., 1989](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B21)), the change in the large intestinal luminal environment and disorder of the epithelial ion transport mechanism of lactose-induced chronic diarrhea remained unclear. Therefore, the objective of the study was to investigate the effect of an incremental high-lactose diet (IHLD, 30%\/40%\/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbiota and Na\\+ absorption.\n\n## Materials and Methods\n### Animals and Diarrhea Induction Using an Incremental High Lactose Diet\nThe experimental procedures followed the guidelines and practices of the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). The procedures were conducted in accordance with the Beijing Administration Office Committee of Laboratory Animals. Male Wistar rats (350–400 g) were housed under an artificial 12 h light-12 dark cycle (lights on at 08:00 h). Forty rats were fed a standard chow diet *ad libitum* and had free access to water for 4 days prior to the induction of diarrhea. Then, all rats were randomly divided into 4 groups of 10 animals each. The control group was fed a standard chow diet; the 30% lactose group was fed 30% lactose for 3 weeks; the 40% lactose group was fed 40% lactose for 3 weeks; and the IHLD group was fed 30–40–50% IHLD, which consisted of 30% lactose for the first week, 40% lactose for the second week and 50% lactose for the third week ([Figure 1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F1)). An IHLD containing 30, 40, and 50% lactose in place of starch was fed to rats (Keao Xieli Feed Co Ltd., Beijing). Rats were monitored for changes in the consistency of pellets and stool mass and fecal fluid. Rats were considered diarrheic if they produced watery, soft, yellowish stools compared to normal, pliable, soft, well-formed pellets as previously described by other researchers ([Boakye et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B8)).\n\nFIGURE 1\n\n![FIGURE 1](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g001.webp)\n\nPlan of experimental animal grouping showing the days for different diets feeding.\n### DNA Extraction and PCR Amplification\nCecal microbiota DNA was extracted using the Omega Stool DNA Kit (Qiagen, United States) and applied to amplification of the V3-V4 region of 16S rDNA with the gene-specific primers ACTCCTACGGGAGGCAGCAG and GGACTACHVGGGTWTCTAAT.PCR reactions were performed on a Mastercycler Gradient (Eppendorf, Germany) using 25 μl reaction volumes containing 12.5 μl of 2× Taq Plus Master Mix, 1 μl of forward primer (5 μM), 1 μl of reverse primer (5 μM), 3 μL of BSA (2 ng\/μL), 5 μl of DNA (total template quantity is 30 ng), and 2.5 μl of ddH2O. PCR amplification was as follows: initiation at 94°C for 5 min, followed by 28 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, with a final extension of 72°C for 7 min. Three PCR products per sample were pooled to mitigate reaction-level PCR biases. The PCR products were purified using a QIAquick Gel Extraction Kit (QIAGEN, Germany), quantified using Real Time PCR, and sequenced at Allwegene Company, Beijing.\n\n### High-Throughput Sequencing\nDeep sequencing was performed on the MiSeq platform at Allwegene Company (Beijing). After the run, image analysis, base calling and error estimation were performed using Illumina Analysis Pipeline Version 2.6.\n\n### Data Analyses\nThe raw data were first screened, and sequences were removed from consideration if they were shorter than 200 bp, had a low quality score (≤20), contained ambiguous bases or did not exactly match primer sequences and barcode tags. Qualified reads were separated using the sample-specific barcode sequences and trimmed with Illumina Analysis Pipeline Version 2.6. Then, the dataset was analyzed using QIIME. The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97% ([Edgar, 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B16)) to generate rarefaction curves and to calculate the richness and diversity indices. The Ribosomal Database Project (RDP) Classifier tool was used to classify all sequences into different taxonomic groups ([Cole et al., 2009](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B14)).\n\nTo examine the similarity between different samples, clustering analyses and PCA were used based on the OTU information from each sample using R ([Wang et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B46)). The evolution distances between microbial communities from each sample were calculated using the tayc coefficient and represented as an Unweighted Pair Group Method with Arithmetic Mean (UPGMA) clustering tree describing the dissimilarity (1-similarity) between multiple samples ([Jiang et al., 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B26)). A Newick-formatted tree file was generated through this analysis. To compare the membership and structure of communities in different samples, heat maps were generated with the top 20 OTUs using Mothur ([Jami et al., 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B25)).\n\n### SCFA, Lactose, Galactose and Lactic Acid Quantity\nThe cecal contents were simply sampled in sterile tubes. Samples were kept frozen at −80°C until analysis. The samples were removed from the freezer, and 1,200 μL of water was added to each thawed sample. The samples were vortexed for 1 min until the material was homogenized. The SCFA content was determined by gas chromatography. Chromatographic analysis was carried out using an Agilent GC system with a flame ionization detector (FID) (Shimadzu Corp, Kyoto, Japan). Fused silica capillary columns 30 m × 0.25 mm coated with 0.25 μm film thickness were used. Nitrogen was used as the carrier gas. The oven temperature was 250°C, and the FID and injection port were set to 300 and 250°C, respectively. The injected sample volume was 1 μL, and the run time for each analysis was 32 min. The chromatograms and data integration were carried out using a Shimadzu C-R5A Chromatopac. The method was performed according to reference ([David et al., 2014](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B15)).\n\nLactose, galactose and lactic acid were detected by corresponding assay kits (ELAC-100, EGAL-100 and ECLC-100, respectively, Bioassay Systems, Hayward, CA, United States) according to the instructions. An aliquot of 50 mg of cecal and proximal colon content samples was dissolved in deionized water, vortexed for 20 s and centrifuged at 12,000 × *g* for 10 min at 4°C. The supernatant was eluted from HLB cartridges and evaporated to dryness under a nitrogen stream. Then, 50 μl of deionized water was added to the tube and redissolved.\n\n### Ussing Chamber Experiments\nThe distal colon was cut longitudinally along the mesenteric border. The serosa, muscularis and submucosa layers were stripped away with fine forceps to prepare a mucosa sample. Stripped mucosa was mounted in a modified Ussing Chamber in a tissue holder (Easy Mount Chamber; Physiologic Instruments, San Diego, CA, United States) with an aperture surface area of 0.3 cm2. Each sample was bathed bilaterally in Krebs-Henseleit solution (KHS). A short-circuit current was measured *in vitro* in Ussing chambers. Transepithelial PD was then clamped at 0 mV, and the short-circuit current (*I**SC*) was recorded with a VCCMC6 voltage-current clamp amplifier (Physiologic Instruments, San Diego, CA, United States). Transepithelial resistance (TR) (Ω∗cm2) was measured by altering the membrane potential in a stepwise fashion (0.1 mV) and calculated from the ohmic relationship.\n\n### Solutions and Chemicals\nKrebs-Henseleit solution (KHS) (mmol\/L): NaCl, 117; KCl, 4.7; MgCl2, 1.2; KH2PO4, 1.2; NaHCO3, 24.8; CaCl2, 2.5; and glucose, 11.1. The solution was bubbled with 95% O2 and 5% CO2 to maintain a pH value of 7.4. Na\\+ free: NMDGCl 117; KCl 4.7; MgCl2.6H2O 1.2; KH2PO3 1.2; choline HCO3 25; CaCl2.2H2O 2.56; GS 11.1.\n\nThe indomethacin, tetrodotoxin (TTX), DPC, amiloride, and forskolin, were purchased from Sigma (St. Louis, MO, United States). Stock solutions of all the above chemicals were dissolved in DMSO. The final DMSO concentration never exceeded 0.1% (v\/v). Preliminary experiments indicated that the vehicle did not alter any baseline electrophysiological parameters.\n\n### Western Blotting\nTissue samples were collected from the colon mucosa of the control and high-lactose diets. Tissues were homogenized and sonicated in cold lysis buffer with protein inhibitiors and phosphatase inhibitors (Beyotime Biotechnology, Beijing). After 30 min standing in 4°C, the samples were then centrifuged at 12,000 × *g* for 30 min at 4°C. The pellets were discarded, and the supernatant was used for blotting. The proteins (50 μg) were separated via 8 or 10% SDS\/PAGE. The blot was washed with Tris-buffered saline containing Tween-20 (TBST) and incubated overnight at 4°C with polyclonal primary antibodies against MCT1, sMCT1, NKCC1, and CFTR ([Supplementary Table S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS1)) and the rabbit polyclonal anti-actin antibody ([Supplementary Table S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS1)). After washing with TBST, the membranes were incubated with secondary antibodies ([Supplementary Table S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS1)).\n\n### Immunostaining\nThe specimens were fixed with 4% paraformaldehyde for 10 min at 25°C, rinsed three times, and incubated with blocking serum for 1 h and anti-MCT, anti-sMCT1, anti-NHE3, anti-NKCC1 and anti-CFTR antibodies overnight at 4°C. After washing with PBS, the specimens were incubated with secondary antibodies. All antibodies in the experiments were shown in the [Supplementary Material](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#FS1) ([Supplementary Table S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS1)). Images were obtained using a fluorescence microscope (Leica DM2500, Germany) with 20× or 40× dry lens.\n\n### Statistical Analyses\nAll data are presented as the mean ± SEM. Differences between three groups were evaluated using ANOVA with Prism software (version 9.1, SAS Institute, Inc.), and those between two groups were assessed using the *t*\\-test. The Wilcoxon *t*\\-test was used to compare microbial communities between two groups. Principal component analysis (PCA) plots of bacterial populations were created using Metaboanalyst 3.0. LEfSe analysis of the treatment group was performed on the basis of the results of the Wilcoxon tests, and the threshold on the logarithmic linear discriminant analysis (LDA) score was 3. Significance was defined as *P* \\< 0.05.\n\n## Results\n### Effect of IHLD-Induced Diarrhea on the Fecal Form, Fecal Fluid Content and Weight\nAfter 30% lactose administration for 48 h, we observed that the majority of rats began to produce wet, loose and yellowish stools. On the 7th day and 14th day, we changed to 40 and 50% lactose and found profuse, watery stools visibly containing lots of mucus with or without a structural pellet form ([Table 1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#T1)). Compared to 30% lactose for 3 weeks, the graded increase in the concentration of lactose avoided the adaptation of rats to lactose and exhibited considerably more diarrhea than the same concentration of 30% lactose for 3 weeks. From our data, IHLD-fed rats could induce persistent and chronic diarrhea compared with only 30 or 40% lactose for 3 weeks, which can avoid adaptation to lactose in rats ([Table 1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#T1)). In the first week, the majority of diarrheic rats (80 and 90%) showed severe diarrhea with profuse, watery stools containing mucus after 30 and 40% lactose diet. In the 3rd week, the fecal characteristics of most rats in the 30 or 40% lactose group showed loose and soft stool pellets, suggesting that diarrhea began to improve. 20% of rats in the IHLD group produced profuse, loose, wet and mucoid stools, and 40% of rats in the IHLD group produced many loose, yellowish, wet stools with or without the structural form of pellets.\n\nTABLE 1\n\n|   |   |   |   |   |   |\n|---|---|---|---|---|---|\n| Diets | Form of stool after 48 h to 21st day |   |   |   |   |\n|   | Watery diarrhea + mucous (incontinence or profuse) | Loose stools + mucous (non-structural stool) | Loose stool with structural form of pellet | Soft formed pellets | Hardened normal pellets |\n| Standard chow diet | – | – | – | \\++ | \\++++ |\n| 30% lactose diet 1st w | \\+++ | \\++ | \\+ | \\+ | – |\n| 40% lactose diet 1st w | \\++++ | \\++++ | – | – | – |\n| IHLD 1st w | \\+++ | \\++ | \\+ | \\+ | – |\n| 30% lactose diet 2nd w | – | \\+ | \\+ | \\+ | – |\n| 40% lactose diet 2nd w | \\++ | \\++ | \\++ | – | – |\n| IHLD 2rd w | \\+ | \\++ | \\+ | \\+ | – |\n| 30% lactose diet 3rd w | \\+ | – | \\++ | \\++ | \\+ |\n| 40% lactose diet | – | \\+ | \\++ | \\+ | – |\n| 3rd w IHLD 3rd w | \\+ | \\+ | \\++ | \\+ | – |\n\nComparison of the severity of diarrhea after single high lactose (30 or 40%) or incremental high lactose diet (30%\/40%\/50%) feeding for 3 weeks.\n\n*IHLD: incremental high-lactose diet 1st w: the first week, 2nd w: second week, 3rd w: third week. Qualitative assessment score or classification: – condition not observed, + is the observed once\/day; ++ is the observed twice\/day. +++ is the observed 3–4 times\/day, ++++ is the abundantly observed and +++++ is the almost exclusively observed.*\n\nThe IHLD caused a significant increase in fecal fluid content, as fluid content constituted 79% of stool mass compared with 16% in pellets produced by rats fed the standard diet ([Figure 2A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2); *P* \\< 0.001). Furthermore, IHLD significantly decreased the fecal pH value compared with that of control rats ([Figure 2B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2), *P* \\< 0.001). In addition, an IHLD significantly decreased weight ([Figure 2C](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2)), similar to previous studies ([Liuzzi and Hevia, 1998](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B34); [Boakye et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B8)). The everyday average food consumption and water intake were mildly decreased compared to those of the control group ([Figures 2D,E](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2)). The average urine volume were almost same among the four groups ([Figure 2F](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2)).\n\nFIGURE 2\n\n![FIGURE 2](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g002.webp)\n\nSummary data on the characteristics of animals after 30 and 40% lactose and IHLD (30%\/40%\/50%) lactose diet feeding for 21 days. **(A)** The three kinds of HLD models caused dramatic increases of 3-fold, 4.2-fold, and 4-fold of the fecal fluid content, respectively. **(B)** Fecal pH significantly decreased after three kinds of HLD feeding. **(C)** Three kinds of HLD models caused significant weight loss compared with the standard chow diet (control, *P* \\< 0.001). **(D)** IHLD (30%\/40%\/50%) reduced the average food consumption, but 30 and 40% lactose diet food consumption did not significantly alter it. **(E)** Water intake was decreased after IHLD, but there were no significant differences between IHLD and control. **(F)** IHLD did not affect average urine compared with control rats. The numbers under the bar graph indicate the rat number. \\*\\**P* \\< 0.01, \\*\\*\\**P* \\< 0.001.\n### Microbial Dysbiosis After Incremental High-Lactose Diet\nIncremental high-lactose diet induced significant alterations in the composition of the luminal microbiota of the cecum by 16S rRNA-Amplicon sequencing. A total of 14 samples from the two groups were analyzed by high-throughput pyrosequencing, which generated 1,133,201 clean tags. After IHLD, the Shannon and Chao 1 indexes revealed that the diversity and richness of the microbial communities were significantly lower than those in the control group ([Figure 3A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F3)). Briefly, the results of PCA (Principal component analysis) showed that the composition of the luminal microbiota of IHLD formed a totally different cluster in the ordination plot, suggesting that IHLD caused major changes in the gut microbiome profiles ([Figure 3B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F3)).\n\nFIGURE 3\n\n![FIGURE 3](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g003.webp)\n\nThe diversity, richness, and microbial composition in the IHLD group differ from those of the control. **(A)** OTU richness and diversity indices. **(B)** Principal component analysis of cecal microbiota on the OTU level.\n\nUnivariate analysis (LDA effect size) was performed to identify the key phyla and genera that exhibited large alterations in microbial composition after IHLD ([Figure 4A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4)). At the phylum level, the abundance of Bacteroidetes (16.54% versus 0.029%) and Verrucomicrobia (1.01% versus 0.0036%) significantly decreased, whereas that of Proteobacteria significantly increased after IHLD (0.58% versus 6.28%) ([Figure 4B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4) and [Supplementary Table S2](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS2)). At the genus level, the abundance of 139 genera showed significant differences between the two groups. The IHLD group showed a marked increase compared to the control group in the relative abundances of Bifidobacterium (0.004% versus 1.12%), Escherichia-Shigella (0.02% versus 5.7%), Megamonas (0.23% versus 20.33%), and Lactobacillus (21.85% versus 70.85%) ([Figure 4B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4) and [Supplementary Table S2](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS2)). In contrast, the concentrations of 59 genera were decreased to zero in the IHLD group, as shown in the [Supplementary Table S2](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS2), including SCFA-producing bacteria such as Ruminococcaceae UCG-013 ([Figure 4C](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4)), Lachnospiraceae UCG-001 and Lachnospiraceae FCS020 group, also including lactose-fermenting Roseburia species increased by administration of a highly purified short-chain galactooligosaccharide (GOS) ([Azcarate-Peril et al., 2017](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B3)).\n\nFIGURE 4\n\n![FIGURE 4](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g004.webp)\n\nChanges in the composition of luminal microbiota at the phylum and genus levels between the control and IHLD groups. LEfSe analysis of the differences between two groups at the phylum and genus levels. **(A)** Heatmap of the relative abundances of predominant phyla **(B)** and genera \\[top 20, **(C)**\\]. The heatmap plot depicts the relative percentage of each bacteria depicted by color intensity with the legend indicated at the bottom of the figure.\n\nCorrelation analyses were performed to identify the relationships between microbial genera and lactose fermentation products including lactose, galactose, lactate and SCFAs. The results showed the relative abundances of four genera, including Lactobacillus, Bifidobacterium, Megamonas and Escherichia Shigella, showing a strong relationship with lactose, galactose and lactate ([Figure 5](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F5)). Among them, the relative abundance of lactobacilli, as the best-known lactic acid-producing bacteria, was 3.3-fold higher in IHLD than in the control. Another 16 genera, especially Allobaculum, Akkermansia, Lactobacillus, Bifidobacterium, and Bacteroides, with very low relative abundances showed a close association with the concentration of SCFAs.\n\nFIGURE 5\n\n![FIGURE 5](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g005.webp)\n\nConstrained correspondence analysis revealing the correlations between the relative abundance of the microbial genus and the concentrations of lactose and lactose fermentation products.\n### SCFA, Lactose, Galactose and Lactic Acid Quantification in the Cecal Luminal Contents\nThe SCFA concentration is high in the cecum and proximal colon since SCFAs are produced by microbial fermentation in the cecum ([Tan et al., 2014](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B41); [Kuwahara et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B31)). Therefore, we investigated the concentration of SCFAs in the cecum. Lactose, galactose, lactic acid and SCFAs were quantified in cecal contents in the control and model groups. Interestingly, a significant decrease in the concentration of SCFAs was observed in the intestinal contents in the IHLD group in contrast to the control group. Acetate, propionate and butyrate were 140% lower in the cecum in the model group than in the control group, as presented in [Figures 6A,B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F6), suggesting that SCFA production was lower in the colon. In contrast, lactose, galactose and lactic acid concentrations were 10-, 6-, and 15-fold higher in the IHLD group, respectively than in the control group ([Figure 6C](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F6)). The results suggested that the high concentrations of lactose, lactic acid and galactose in the colon lumen but not SCFAs led to hyperosmosis in the colon, which would be the major reason for diarrhea.\n\nFIGURE 6\n\n![FIGURE 6](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g006.webp)\n\nTotal amounts of short-chain fatty acids (SCFAs) and lactose, galactose and lactic acid in the cecum luminal contents. **(A)** Chromatogram of SCFAs, including acetate, propionate, butyrate and 2-ethylbutyric acid (internal standard). **(B)** SCFAs in the cecum were significantly decreased in IHLD compared to control (\\*\\**P* \\< 0.01, \\*\\*\\**P* \\< 0.001). **(C)** The concentrations of lactose, galactose and lactic acid were significantly increased in the IHLD group compared to the control group. The numbers under the bar graph indicate the rat number.\n### Expression and Location of MCT and sMCT1 in the Colon of the IHLD Group and Control Group\nMCT1 is an H\\+\\-coupled transporter expressed in the apical membrane and basolateral membrane of the colonic epithelium ([Ritzhaupt et al., 1998](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B36); [Kirat et al., 2009](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B29)), mediating SCFA influx from the lumen and SCFA efflux into the blood ([Iwanaga et al., 2006](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B24)). The western blot results showed that the expression level of MCT1 protein in the colon of the IHLD group was lower by 65% than that in the control group ([Figures 7A,B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)). Moreover, the number and intensity of MCT1 immunopositive cells were greatly decreased in lactose-fed rats ([Figures 7E,F](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)) compared with control animals ([Figures 7C,D](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)), confirming the western blot results.\n\nFIGURE 7\n\n![FIGURE 7](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g007.webp)\n\nMCT1 and sMCT1 expression and location after IHLD. Western blot analysis of total MCT1 and sMCT1 in the colon of the control and IHLD models. Images are representative immunoblots of MCT1, sMCT1, and β-actin from five animals in each group **(A)**; densitometric analysis of MCT1 and sMCT1 abundance in colon between control and IHLD model group (\\*\\**P* \\< 0.01) **(B)**. Immunofluorescence staining of MCT1 and sMCT1 in colonic sections of the control **(C,D,G)** and IHLD model **(E,F,H)**. Panels **(D,F)** are higher magnification images of the white rectangles in panels **(C,E)**, respectively. The immunoblots are representative of the results obtained from five animals in the model group. Scale bar = 50 μm.\n\nsMCT1 is a Na\\+\\-coupled transporter expressed solely on the apical membrane of the colonic epithelium that mediates SCFA influx from the lumen ([Ritzhaupt et al., 1998](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B36); [Kuwahara et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B31)). The western blot results showed that the expression level of sMCT1 did not change in IHLD rats compared to the control rats, as shown in [Figure 7A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7), consistent with the immunofluorescence results ([Figures 7G,H](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)).\n\n### Involvement of Na\\+ Absorption and Anion Secretion in the Colon of the IHLD-Induced Diarrhea Group\nIn order to investigate the basal and stimulated ion transport in the colonic epithelium of the IHLD group, a Ussing Chamber experiment was performed. In short circuit current recording, the basal current represents a summation of all ionic currents across the epithelium ([Xue et al., 2007](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B49); [Clarke, 2009](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B13)). The basal *I**SC* was lower in the IHLD-model group (IHLD: 48 ± 5.15 μA\/cm2 versus control: 108 ± 37.23 μA\/cm2, *n* = 10, [Figure 7A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)). In apical Na\\+\\-free KHS, the basal *I**SC* without apical Na\\+ absorption in the colonic mucosa of the control group was similar to that of the IHLD group (IHDL: −86.42 ± 7.8 μA\/cm2 versus control: −89.69 ± 11.41 μA\/cm2, *n* = 11). However, the Δbasal *I**SC* (subtract the basal *I**SC* in apical Na\\+\\-free KHS from the basal *I**SC* in normal KHS) in the colonic mucosa of the IHLD group was significantly decreased (IHLD 134.4 ± 2.65 μA\/cm2 versus control: 197.8 ± 25.82 μA\/cm2, *n* = 10, [Figure 7A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)), suggesting that Na\\+ absorption was lower in the IHLD group. After apical treatment with the ENaC inhibitor amiloride, a similar inhibition of basal *I**SC* was observed in the control and IHLD groups, excluding the ENaC involved in the ion transport of the IHLD group (IHLD: −6.54 ± 1.73 μA\/cm2 versus control: −6.98 ± 2.22 μA\/cm2, [Supplementary Figure S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#FS1)). As [Figure 8](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F8) shown, the results of western blotting and immunostaining showed that the level of total protein expression and phosphorylation of NHE3 protein-mediated Na\\+ absorption in the colon were downregulated by 37 and 67% respectively, in the model group compared with the control group ([Figures 8B–G](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F8)), which was responsible for the low Na\\+ absorption.\n\nFIGURE 8\n\n![FIGURE 8](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g008.webp)\n\nDecreased NHE3 expression and phosphorylation levels and Na\\+ absorption involved in lactose-induced chronic diarrhea. Baseline *I**SC* current and delta basal *I**SC* in colonic epithelium between the control and IHLD groups (\\**P* \\< 0.05, \\*\\**P* \\< 0.01) **(A)**. Western blot analysis of total NHE3 and phosphorylated NHE3 in the colon of the control and IHLD models. **(B,C)** Images are representative immunoblots of NHE3 and phosphorylated NHE3 from five animals in each group **(B)**. densitometric analysis of NHE3 and relative NHE3 phosphorylation (pNHE3\/NHE3) in colon between control and IHLD model group (\\**P* \\< 0.05) **(C)** Immunofluorescence staining of NHE3 and phosphorylated NHE3 in the colon between the control **(D,F)** and model **(E,G)** groups. The right inset is zoomed image of white rectangle **(D,E)**. Scale bar = 50 μm.\n\nFurthermore, the cAMP elevator forskolin (1 μM, basolateral)-induced *I**SC* increase in the colon of the IHLD group was lower than that in the control group (IHLD: 128.3 ± 15.3 μA\/cm2 versus control: 201.4 ± 28.31 μA\/cm2, [Figure 9A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F9)). The inhibition of basal *I**SC* induced by apical treatment with a known CFTR inhibitor DPC (diphenylamine-2, 2′-dicarboxylic acid), was significantly higher in the control group than in the IHLD group, suggesting that CFTR-mediated Cl– secretion under basal conditions was decreased in the IHLD group compared with the control group (IHLD: −1.12 ± 1.74 μA\/cm2 versus control: −8.10 ± 2.14 μA\/cm2, [Supplementary Figure S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#FS1)). The western blot and immunostaining results showed that the protein expression levels of NKCC1 and CFTR in the colonic mucosa were decrease by 50 and 24%,respectively, than those in the control group, contributing to the lower basal and stimulated ion secretion in the model group ([Figures 9B–G](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F9)).\n\nFIGURE 9\n\n![FIGURE 9](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g009.webp)\n\nMucosal secretory responses and expression of CFTR and NKCC1 in rats after IHLD\/SD feeding for 21 days. Forskolin-stimulated *I**SC***(A)** in the colonic epithelium (\\**P* \\< 0.05). The numbers under the bar graph are the samples number from four different rats. Western blot analysis of total NKCC1 and CFTR in the colon of the control and IHLD models. (\\**P* \\< 0.05). **(B,C)** Images are representative immunoblots of CFTR and NKCC1 from five animals in each group. Immunofluorescence staining of NKCC1 **(D,E)** and CFTR **(F,G)** in the colon between the control **(D,F)** and model **(E,G)** groups. Scale bar = 50 μm.\n### Discussion\nLactose intolerance (LI) appears to be mainly associated with unabsorbed lactose in the small intestine passing into the colon and being metabolized by colonic bacteria to organic acids, including lactic acid and short-chain fatty acids. The organic acids escaping absorption by the colon remain in the colonic lumen and lead to osmotic diarrhea. Previous studies have shown that lactose-induced diarrhea results, in large part, from the combination of net fluid secretion by the stomach and small intestine and interference with net fluid absorption in the colon ([Christopher and Bayless, 1971](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B12); [Hammer et al., 1989](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B21)).\n\nIn our study, we established a chronic diarrhea model using lactose with a gradual increase in concentration for 3 weeks to investigate the mechanism of high lactose-induced diarrhea on organic acid production and ion transport of the colonic epithelium and NHE3, CFTR and NKCC1 expression combined with epithelial locations, which are associated with Na\\+ absorption and Cl– secretion.\n\nThe concentrations of lactose, galactose and lactic acid in the cecum in the IHLD model group were higher than those in the control group, but the concentration of SCFAs was lower, suggesting that the major reason for hyperosmosis is due to high concentrations of lactose, galactose and lactic acid in the intestinal lumen, which could cause osmotic diarrhea. Furthermore, the concentration of lactic acid in the cecum content was much higher than that in the control group, which was responsible for the low pH in the feces. Adult rats, as mammals, have intestinal lactase activity that decreases quickly upon weaning, and research has shown that although residual lactase activity is present in adult rats, a high-lactose diet is poorly digested by adult rats ([Alexandre et al., 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B2); [van de Heijning et al., 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B43)). The increase in galactose in the cecum contents after chronic feeding with high lactose might be due to microbiota fermentation. As expected, our results showed that significant differences were observed in the composition of cecum microbiota via high-throughput MiSeq sequencing after IHLD. A previous study ([Francavilla et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B18)) investigated the influence of lactose on the composition of the gut microbiota and the SCFAs of infants with cow’s milk allergy. Similar to our findings, lactose intake can induce an increase in Bifidobacteria and Lactobacilli and a decrease in the numbers of Bacteroides, Prevotella and Clostridia. In addition, we also found that the increased abundances of another two genera, Escherichia-shigella and Megamonas, were positively related to the concentrations of lactose, galactose and lactic acid and might be responsible for the IHLD-induced diarrhea. They also measured SCFA levels and found that the concentration of SCFA increased after addition of lactose, which was the opposite result of our study because of the differences between from infants and adults. In addition, we found the loss of important SCFA-producing microbes, such as lachnospiraceae NK4A136 group and ruminococcaceae UCG-005, after IHLD, which might lead to the lower concentration of luminal SCFAs, consistent with a recent study on a high-sugar diet ([Laffin et al., 2019](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B32)). Another recent study ([Kamphuis et al., 2019](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B28)) showed that oral gavage with lactose at a modest dose of 5 mg\/day for 3 weeks did not induce alterations in the fecal microbiota of mice, which was different from our study because of the low dose of lactose without significant malabsorption.\n\nIn our results, we found that the concentrations of SCFAs in the cecal contents of the model group was significantly decreased compared with that of the control group, which was different from a previous study that showed that an increase in SCFAs resulted in acute ingestion of lactose *in vivo* and *in vitro* ([He et al., 2006](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B22); [Windey et al., 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B48)). Few studies have focused on the effect of chronic lactose intervention on SCFAs, and a recent study ([Zhai et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B51)) found no significant difference in the SCFA concentration of feces after 3 weeks of lactulose intervention in mice, suggesting a different mechanism between acute and chronic ingestion. In the colon, SCFAs are absorbed by MCT1 and sMCT1 in the colon epithelium. Our results showed that an unaltered expression level and differential distribution of sMCT1 were observed between the control group and IHLD group. However, MCT1 expression was significantly decreased, showing that its low expression level might be caused by lower SCFAs in the lumen, which is also reported to be regulated by butyrate ([Borthakur et al., 2008](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B10), [2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B9)).\n\nCurrently, there is growing evidence indicating that SCFAs are a product of bacterial fermentation involved in the regulation of ion transport ([Yajima et al., 2011](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B50); [Tan et al., 2014](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B41); [Kuwahara et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B31)). Previous studies demonstrated that luminal addition of propionate stimulates chloride secretion, which function as a lubricant for the movement of luminal contents in the colon ([Yajima et al., 2011](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B50)). It has been reported that NHE3 mediates Na\\+ absorption in the colon, and our data showed that its expression and phosphorylation level were significantly decreased in the model group, confirming a decrease in Na\\+ absorption. The results of the Ussing Chamber demonstrated that when apical Na\\+ was removed, the delta basal *I**SC* in the IHLD group was significantly decreased, suggesting that Na\\+ absorption was involved in the basal current. It is generally accepted that the absorption of Na\\+ and Cl– in the colon is mutually interdependent, electrically neutral by largely apical Na\/H exchange and Cl\/HCO3 exchange processes, primarily involving the Na\/H exchanger NHE3 and the Cl\/HCO3 exchanger ([Walker et al., 2008](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B45)). The evidence from the present study showed that Na\\+ absorption and NHE3 protein expression and phosphorylation were decreased in IHLD rats compared with control rats, but the RNA level of NHE3 and the change in the expression of the Cl\/HCO3 exchanger involving Cl– absorption still need to be investigated. To the best of our knowledge, no previous report has found that NHE3 is involved in lactose-induced diarrhea and might be a novel target for the attenuation of lactose-induced diarrhea.\n\nIn this study, we used the chronic diarrhea model induced by giving high lactose for 3 weeks, which could employ a compensatory mechanism to adapt to the diarrhea situation. A previous study showed that rats adapted to a lactose diet and that the size of the cecum returned to normal, but its mechanisms are not clear ([Lawrence et al., 1956](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B33); [Szilagyi, 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B40)). Our results showed that basal current and FSK-induced Cl– secretion in the model group were lower than those in the control group, which can result in lower luminal anionic secretion and associated luminal transport of water. Furthermore, the NKCC1 and CFTR expression levels in the colon mucosa in the model group decreased compared with those in the control group, resulting in a decrease in basal and FSK-induced *I**SC*. We considered it to have resulted from the compensatory mechanism. In the duodenum, luminal SCFAs induced HCO−3 3 \\- secretion ([Akiba et al., 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B1)). Our study showed that lower luminal SCFAs decrease Cl– secretion, but the mechanism should be investigated further.\n\nTaken together, IHLD feeding to rats caused a persistent state of diarrhea, and the cecum tripled in size. The concentrations of lactose, galactose and lactic acid were markedly increased in the cecal luminal contents, contributing to lactose intolerance-induced high osmosis diarrhea. Meanwhile, the lumen SCFA concentration of the cecal contents was significantly decreased. This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and an increase in the relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. In addition, the microbiota diversity in the colon was found to be lower in the cecum of IHLD rats compared with control rats. Concomitantly, the expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels in the colonic mucosa of the IHLD group contributed to the Na\\+ absorption and accumulation decrease in the lumen, and the stimulated Cl– secretion decrease would be a compensatory effect for water and electrolyte loss during the diarrhea process ([Figure 10](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F10)). The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbita and Na\\+ absorption.\n\nFIGURE 10\n\n![FIGURE 10](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g010.webp)\n\nSchematic diagram of lactose-induced chronic diarrhea. Amounts of lactose, galactose and lactic acid remaining in the cecum resulted in microbiota dysbiosis, which was related to low lumen SCFAs. Low NHE3 expression and phosphorylation levels in the colonic mucosa of the IHLD group contributed to a decrease in Na\\+ absorption and accumulation in the lumen, and a decrease in stimulated Cl– secretion would compensate for water and electrolyte loss during the diarrhea process.\n## Statements\n### Data availability statement\nThe original contributions presented in the study are publicly available. This data can be found here: <https:\/\/www.ncbi.nlm.nih.gov\/bioproject\/PRJNA611011>.\n\n### Ethics statement\nThe animal study was reviewed and approved by the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2).\n\n### Author contributions\nHX, FW, and XT conceived the study. HX designed the experiment, wrote the manuscript, and performed the western blotting and immunostaining. MZ and JM made the animal models and performed the Ussing Chamber experiments. HX quantified SCFAs. HX and TC analyzed the data. FW and XT supervised the research. All authors contributed to the article and approved the submitted version.\n\n### Funding\nThis work was supported by the National Natural Science Foundation of China (Grant No. 81973838) and National Key Research and Development Project (Grant No. 2016YFC1302203).\n\n### Acknowledgments\nThe authors thank Prof. Wang Jiannong and Dr. Sun Caixia for their help for technical support on GC analyses for measuring SCFA levels.\n\n### Conflict of interest\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\n### Supplementary material\nThe Supplementary Material for this article can be found online at: [https:\/\/www.frontiersin.org\/articles\/10.3389\/fphys.2020.00877\/full\\#supplementary-material](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#supplementary-material)\n\n**FIGURE S1**\n\nComparison of effect of DPC or amiloride on the basal *I**SC* current between control and IHLD group. Values are means ± SEM; *P* \\< 0.05.\n\n**TABLE S1**\n\nAntibodies for western and immunofluorescence.\n\n**TABLE S2**\n\nInformation of statistical test analysis of phylum and genus level between control and IHLD group.\n\n## References\n- 1\n  AkibaY.InoueT.KajiI.NarimatsuK.IwamotoK.et al (2015). Short-chain fatty acid sensing in rat duodenum.**J. Physiol.**593585–599. 10.1113\/jphysiol.2014.280792\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/25433076)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/jphysiol.2014.280792)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=Y..%2BAkiba&author=T..%2BInoue&author=I..%2BKaji&author=K..%2BNarimatsu&author=K..%2BIwamoto&publication_year=2015&title=Short-chain%2Bfatty%2Bacid%2Bsensing%2Bin%2Brat%2Bduodenum.&journal=J.+Physiol.&volume=593&pages=585-599)\n- 2\n  AlexandreV.EvenP. C.LarueA. C.BlouinJ. M.BlachierF.BenamouzigR.et al (2013). Lactose malabsorption and colonic fermentations alter host metabolism in rats.**Br. J. Nutr.**110625–631. 10.1017\/S0007114512005557\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23321004)\n  - [CrossRef](https:\/\/doi.org\/10.1017\/S0007114512005557)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=V..%2BAlexandre&author=P.%2BC..%2BEven&author=A.%2BC..%2BLarue&author=J.%2BM..%2BBlouin&author=F..%2BBlachier&author=R..%2BBenamouzig&publication_year=2013&title=Lactose%2Bmalabsorption%2Band%2Bcolonic%2Bfermentations%2Balter%2Bhost%2Bmetabolism%2Bin%2Brats.&journal=Br.+J.+Nutr.&volume=110&pages=625-631)\n- 3\n  Azcarate-PerilM. A.RitterA. J.SavaianoD.Monteagudo-MeraA.AndersonC.MagnessS. T. (2017). Impact of the short-chain galactooligosaccharides on the gut microbiome of lactose-intolerant individuals.**Proc. Natl. Acad. Sci. U.S.A.**114E367–E375. 10.1073\/pnas.1606722113\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/28049818)\n  - [CrossRef](https:\/\/doi.org\/10.1073\/pnas.1606722113)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=M.%2BA..%2BAzcarate-Peril&author=A.%2BJ..%2BRitter&author=D..%2BSavaiano&author=A..%2BMonteagudo-Mera&author=C..%2BAnderson&author=S.%2BT..%2BMagness&publication_year=2017&title=Impact%2Bof%2Bthe%2Bshort-chain%2Bgalactooligosaccharides%2Bon%2Bthe%2Bgut%2Bmicrobiome%2Bof%2Blactose-intolerant%2Bindividuals.&journal=Proc.+Natl.+Acad.+Sci.+U.S.A.&volume=114&pages=E367-E375)\n- 4\n  BaylessT. M.BrownE.PaigeD. M. (2017). Lactase Non-persistence and Lactose Intolerance.**Curr. Gastroenterol. Rep**19:23. 10.1007\/s11894-017-0558-9\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/28421381)\n  - [CrossRef](https:\/\/doi.org\/10.1007\/s11894-017-0558-9)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T.%2BM..%2BBayless&author=E..%2BBrown&author=D.%2BM..%2BPaige&publication_year=2017&title=Lactase%2BNon-persistence%2Band%2BLactose%2BIntolerance.&journal=Curr.+Gastroenterol.+Rep&volume=19)\n- 5\n  BinderH. J. (2010). Role of Colonic Short-chain fatty acid transport in diarrhea.**Annu. Rev. Physiol*.*72297–313. 10.1146\/annurev-physiol-021909-135817\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/20148677)\n  - [CrossRef](https:\/\/doi.org\/10.1146\/annurev-physiol-021909-135817)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BJ..%2BBinder&publication_year=2010&title=Role%2Bof%2BColonic%2BShort-chain%2Bfatty%2Bacid%2Btransport%2Bin%2Bdiarrhea.&journal=Annu.+Rev.+Physiol.&volume=72&pages=297-313)\n- 6\n  BinderH. J.FosterE. S.BudingerM. E.HayslettJ. P. (1987). Mechanism of electroneutral sodium chloride absorption in distal colon of the rat.**Gastroenterology**93449–455. 10.1016\/0016-5085(87)90905-x\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/0016-5085\\(87\\)90905-x)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BJ..%2BBinder&author=E.%2BS..%2BFoster&author=M.%2BE..%2BBudinger&author=J.%2BP..%2BHayslett&publication_year=1987&title=Mechanism%2Bof%2Belectroneutral%2Bsodium%2Bchloride%2Babsorption%2Bin%2Bdistal%2Bcolon%2Bof%2Bthe%2Brat.&journal=Gastroenterology&volume=93&pages=449-455)\n- 7\n  BinderH. J.SandleG. I.RajendranV. M. (1991). “Colonic fluid and electrolyte transport in health and disease,” in **The Large Intestine: Physiology, Pathophysiology, and Disease**, edsPhillipsS. F.PembertonJ. H.ShorterR. G. (New York, NY: Raven Press), 141–168.\n  \n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BJ..%2BBinder&author=G.%2BI..%2BSandle&author=V.%2BM..%2BRajendran&publication_year=1991&title=Colonic%2Bfluid%2Band%2Belectrolyte%2Btransport%2Bin%2Bhealth%2Band%2Bdisease&journal=The+Large+Intestine%3A+Physiology%2C+Pathophysiology%2C+and+Disease&pages=141-168)\n- 8\n  BoakyeP. A.BrierleyS. M.BalembaO. B. (2012). Garcinia buchananii bark extract is an effective anti-diarrheal remedy for lactose-induced diarrhea.**J. Ethnopharmacol.**142539–547. 10.1016\/j.jep.2012.05.034\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22643232)\n  - [CrossRef](https:\/\/doi.org\/10.1016\/j.jep.2012.05.034)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=P.%2BA..%2BBoakye&author=S.%2BM..%2BBrierley&author=O.%2BB..%2BBalemba&publication_year=2012&title=Garcinia%2Bbuchananii%2Bbark%2Bextract%2Bis%2Ban%2Beffective%2Banti-diarrheal%2Bremedy%2Bfor%2Blactose-induced%2Bdiarrhea.&journal=J.+Ethnopharmacol.&volume=142&pages=539-547)\n- 9\n  BorthakurA.PriyamvadaS.KumarA.NatarajanA. A.GillR. K.AlrefaiW. A.et al (2012). A novel nutrient sensing mechanism underlies substrate-induced regulation of monocarboxylate transporter 1.**Am. J. Physiol. Gastrointest. Liver. Physiol.**303G1126–G1133. 10.1152\/ajpgi.00308.2012\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22982338)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/ajpgi.00308.2012)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BBorthakur&author=S..%2BPriyamvada&author=A..%2BKumar&author=A.%2BA..%2BNatarajan&author=R.%2BK..%2BGill&author=W.%2BA..%2BAlrefai&publication_year=2012&title=A%2Bnovel%2Bnutrient%2Bsensing%2Bmechanism%2Bunderlies%2Bsubstrate-induced%2Bregulation%2Bof%2Bmonocarboxylate%2Btransporter%2B1.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=303&pages=G1126-G1133)\n- 10\n  BorthakurA.SaksenaS.GillR. K.AlrefaiW. A.RamaswamyK.DudejaP. K. (2008). Regulation of monocarboxylate transporter 1 (MCT1) promoter by butyrate in human intestinal epithelial cells: Involvement of NF-κB pathway.**J. Cell. Biochem.**1031452–1463. 10.1002\/jcb.21532\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/17786924)\n  - [CrossRef](https:\/\/doi.org\/10.1002\/jcb.21532)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BBorthakur&author=S..%2BSaksena&author=R.%2BK..%2BGill&author=W.%2BA..%2BAlrefai&author=K..%2BRamaswamy&author=P.%2BK..%2BDudeja&publication_year=2008&title=Regulation%2Bof%2Bmonocarboxylate%2Btransporter%2B1%2B%28MCT1%29%2Bpromoter%2Bby%2Bbutyrate%2Bin%2Bhuman%2Bintestinal%2Bepithelial%2Bcells%3A%2BInvolvement%2Bof%2BNF-%CE%BAB%2Bpathway.&journal=J.+Cell.+Biochem.&volume=103&pages=1452-1463)\n- 11\n  BryceJ.BoschiP. C.ShibuyaK.BlackR. E. (2005). WHO estimates of the causes of death in children.**Lancet**3651147–1152. 10.1016\/S0140-6736(05)71877-8\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/S0140-6736\\(05\\)71877-8)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J..%2BBryce&author=P.%2BC..%2BBoschi&author=K..%2BShibuya&author=R.%2BE..%2BBlack&publication_year=2005&title=WHO%2Bestimates%2Bof%2Bthe%2Bcauses%2Bof%2Bdeath%2Bin%2Bchildren.&journal=Lancet&volume=365&pages=1147-1152)\n- 12\n  ChristopherN. L.BaylessT. M. (1971). Role of the small bowel and colon in lactose-induced diarrhea.**Gastroenterology**60845–852. 10.1016\/s0016-5085(71)80083-5\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/s0016-5085\\(71\\)80083-5)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=N.%2BL..%2BChristopher&author=T.%2BM..%2BBayless&publication_year=1971&title=Role%2Bof%2Bthe%2Bsmall%2Bbowel%2Band%2Bcolon%2Bin%2Blactose-induced%2Bdiarrhea.&journal=Gastroenterology&volume=60&pages=845-852)\n- 13\n  ClarkeL. L. (2009). A guide to Ussing chamber studies of mouse intestine.**Am. J. Physiol. Gastrointest. Liver. Physiol.**296G1151–G1166. 10.1152\/ajpgi.90649.2008\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/19342508)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/ajpgi.90649.2008)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=L.%2BL..%2BClarke&publication_year=2009&title=A%2Bguide%2Bto%2BUssing%2Bchamber%2Bstudies%2Bof%2Bmouse%2Bintestine.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=296&pages=G1151-G1166)\n- 14\n  ColeJ. R.WangQ. E.CardenasJ.FishB.ChaiR. J.FarrisA. S.et al (2009). The ribosomal database project: improved alignments and new tools for rRNA analysis.**Nucleic Acids Res.**37D141–D145. 10.1093\/nar\/gkn879\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/19004872)\n  - [CrossRef](https:\/\/doi.org\/10.1093\/nar\/gkn879)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J.%2BR..%2BCole&author=Q.%2BE..%2BWang&author=J..%2BCardenas&author=B..%2BFish&author=R.%2BJ..%2BChai&author=A.%2BS..%2BFarris&publication_year=2009&title=The%2Bribosomal%2Bdatabase%2Bproject%3A%2Bimproved%2Balignments%2Band%2Bnew%2Btools%2Bfor%2BrRNA%2Banalysis.&journal=Nucleic+Acids+Res.&volume=37&pages=D141-D145)\n- 15\n  DavidL. A.MauriceC. F.ButtonJ. E.WolfeB. E.et al (2014). Diet rapidly and reproducibly alters the human gut microbiome.**Nature**505559–563. 10.1038\/nature12820\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/24336217)\n  - [CrossRef](https:\/\/doi.org\/10.1038\/nature12820)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=L.%2BA..%2BDavid&author=C.%2BF..%2BMaurice&author=J.%2BE..%2BButton&author=B.%2BE..%2BWolfe&publication_year=2014&title=Diet%2Brapidly%2Band%2Breproducibly%2Balters%2Bthe%2Bhuman%2Bgut%2Bmicrobiome.&journal=Nature&volume=505&pages=559-563)\n- 16\n  EdgarR. C. (2013). UPARSE: Highly accurate OTU sequences from microbial amplicon reads.**Nat Methods**10996–998. 10.1038\/nmeth.2604\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23955772)\n  - [CrossRef](https:\/\/doi.org\/10.1038\/nmeth.2604)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=R.%2BC..%2BEdgar&publication_year=2013&title=UPARSE%3A%2BHighly%2Baccurate%2BOTU%2Bsequences%2Bfrom%2Bmicrobial%2Bamplicon%2Breads.&journal=Nat+Methods&volume=10&pages=996-998)\n- 17\n  FassioF.FacioniM. S.GuagniniF. (2018). Lactose maldigestion, malabsorption, and intolerance: a comprehensive review with focus on current management and future perspectives.**Nutrients**10:1599. 10.3390\/nu10111599\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/30388735)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/nu10111599)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=F..%2BFassio&author=M.%2BS..%2BFacioni&author=F..%2BGuagnini&publication_year=2018&title=Lactose%2Bmaldigestion%2C%2Bmalabsorption%2C%2Band%2Bintolerance%3A%2Ba%2Bcomprehensive%2Breview%2Bwith%2Bfocus%2Bon%2Bcurrent%2Bmanagement%2Band%2Bfuture%2Bperspectives.&journal=Nutrients&volume=10)\n- 18\n  FrancavillaR.CalassoM.CalaceL.SiragusaS.NdagijimanaM.VernocchiP.et al (2012). Effect of lactose on gut microbiota and metabolome of infants with cow’s milk allergy.**Pediatr. Allergy Immunol.**3420–427. 10.1111\/j.1399-3038.2012.01286.x\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22435727)\n  - [CrossRef](https:\/\/doi.org\/10.1111\/j.1399-3038.2012.01286.x)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=R..%2BFrancavilla&author=M..%2BCalasso&author=L..%2BCalace&author=S..%2BSiragusa&author=M..%2BNdagijimana&author=P..%2BVernocchi&publication_year=2012&title=Effect%2Bof%2Blactose%2Bon%2Bgut%2Bmicrobiota%2Band%2Bmetabolome%2Bof%2Binfants%2Bwith%2Bcow%E2%80%99s%2Bmilk%2Ballergy.&journal=Pediatr.+Allergy+Immunol.&volume=3&pages=420-427)\n- 19\n  GanapathyV.GopalE.MiyauchiS.PrasadP. D. (2005). Biological functions of SLC5A8,candidate tumour suppressor.**Biochem. Soc. Trans.**33(Pt 1)237–240. 10.1042\/BST0330237\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/15667316)\n  - [CrossRef](https:\/\/doi.org\/10.1042\/BST0330237)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=V..%2BGanapathy&author=E..%2BGopal&author=S..%2BMiyauchi&author=P.%2BD..%2BPrasad&publication_year=2005&title=Biological%2Bfunctions%2Bof%2BSLC5A8%2Ccandidate%2Btumour%2Bsuppressor.&journal=Biochem.+Soc.+Trans.&volume=33%28Pt+1%29&pages=237-240)\n- 20\n  HammerH. F.HammerJ. (2012). Diarrhea caused by carbohydrate malabsorption.**Gastroenterol. Clin. N. Am.**41611–627. 10.1016\/j.gtc.2012.06.003\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22917167)\n  - [CrossRef](https:\/\/doi.org\/10.1016\/j.gtc.2012.06.003)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BF..%2BHammer&author=J..%2BHammer&publication_year=2012&title=Diarrhea%2Bcaused%2Bby%2Bcarbohydrate%2Bmalabsorption.&journal=Gastroenterol.+Clin.+N.+Am.&volume=41&pages=611-627)\n- 21\n  HammerH. F.Santa AnaC. A.SchillerL. R.FordtranJ. S. (1989). Studies of osmotic diarrhea induced in normal subjects by ingestion of polyethylene glycol and lactulose.**J. Clin. Invest.**841056–1062. 10.1172\/JCI114267\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/2794043)\n  - [CrossRef](https:\/\/doi.org\/10.1172\/JCI114267)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BF..%2BHammer&author=C.%2BA..%2BSanta%2BAna&author=L.%2BR..%2BSchiller&author=J.%2BS..%2BFordtran&publication_year=1989&title=Studies%2Bof%2Bosmotic%2Bdiarrhea%2Binduced%2Bin%2Bnormal%2Bsubjects%2Bby%2Bingestion%2Bof%2Bpolyethylene%2Bglycol%2Band%2Blactulose.&journal=J.+Clin.+Invest.&volume=84&pages=1056-1062)\n- 22\n  HeT.PriebeM. G.HarmsenH. J.StellaardF.SunX.WellingG. W.et al (2006). Colonic fermentation may play a role in lactose intolerance in humans.**J. Nutr.**13658–63. 10.1093\/jn\/136.1.58\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/16365059)\n  - [CrossRef](https:\/\/doi.org\/10.1093\/jn\/136.1.58)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T..%2BHe&author=M.%2BG..%2BPriebe&author=H.%2BJ..%2BHarmsen&author=F..%2BStellaard&author=X..%2BSun&author=G.%2BW..%2BWelling&publication_year=2006&title=Colonic%2Bfermentation%2Bmay%2Bplay%2Ba%2Brole%2Bin%2Blactose%2Bintolerance%2Bin%2Bhumans.&journal=J.+Nutr.&volume=136&pages=58-63)\n- 23\n  HoqueK. M.ChakrabortyS.SheikhI. A.WoodwardO. M. (2012). New advances in the pathophysiology of intestinal ion transport and barrier function in diarrhea and the impact on therapy.**Expert Rev. Anti Infect. Ther.**10687–699. 10.1586\/eri.12.47\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22734958)\n  - [CrossRef](https:\/\/doi.org\/10.1586\/eri.12.47)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=K.%2BM..%2BHoque&author=S..%2BChakraborty&author=I.%2BA..%2BSheikh&author=O.%2BM..%2BWoodward&publication_year=2012&title=New%2Badvances%2Bin%2Bthe%2Bpathophysiology%2Bof%2Bintestinal%2Bion%2Btransport%2Band%2Bbarrier%2Bfunction%2Bin%2Bdiarrhea%2Band%2Bthe%2Bimpact%2Bon%2Btherapy.&journal=Expert+Rev.+Anti+Infect.+Ther.&volume=10&pages=687-699)\n- 24\n  IwanagaT.TakebeK.KatoI.KarakiS.KuwaharaA. (2006). Cellular expression of monocarboxylate transporters (MCT) in the digestive tract of the mouse, rat, and humans, with special reference to slc5a8.**Biomed. Res.**27243–254. 10.2220\/biomedres.27.243\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/17099289)\n  - [CrossRef](https:\/\/doi.org\/10.2220\/biomedres.27.243)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T..%2BIwanaga&author=K..%2BTakebe&author=I..%2BKato&author=S..%2BKaraki&author=A..%2BKuwahara&publication_year=2006&title=Cellular%2Bexpression%2Bof%2Bmonocarboxylate%2Btransporters%2B%28MCT%29%2Bin%2Bthe%2Bdigestive%2Btract%2Bof%2Bthe%2Bmouse%2C%2Brat%2C%2Band%2Bhumans%2C%2Bwith%2Bspecial%2Breference%2Bto%2Bslc5a8.&journal=Biomed.+Res.&volume=27&pages=243-254)\n- 25\n  JamiE.IsraelA.KotserA.MizrahiI. (2013). Exploring the bovine rumen bacterial community from birth to adulthood.**ISME J*.*71069–1079. 10.1038\/ismej.2013.2\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23426008)\n  - [CrossRef](https:\/\/doi.org\/10.1038\/ismej.2013.2)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=E..%2BJami&author=A..%2BIsrael&author=A..%2BKotser&author=I..%2BMizrahi&publication_year=2013&title=Exploring%2Bthe%2Bbovine%2Brumen%2Bbacterial%2Bcommunity%2Bfrom%2Bbirth%2Bto%2Badulthood.&journal=ISME+J.&volume=7&pages=1069-1079)\n- 26\n  JiangX. T.PengX.DengG. H.ShengH. F.WangY.ZhouH. W. (2013). Illumina sequencing of 16S rRNA Tag revealed spatial variations of bacterial communities in a mangrove wetland.**Microb. Ecol.**6696–104. 10.1007\/s00248-013-0238-8\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23649297)\n  - [CrossRef](https:\/\/doi.org\/10.1007\/s00248-013-0238-8)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=X.%2BT..%2BJiang&author=X..%2BPeng&author=G.%2BH..%2BDeng&author=H.%2BF..%2BSheng&author=Y..%2BWang&author=H.%2BW..%2BZhou&publication_year=2013&title=Illumina%2Bsequencing%2Bof%2B16S%2BrRNA%2BTag%2Brevealed%2Bspatial%2Bvariations%2Bof%2Bbacterial%2Bcommunities%2Bin%2Ba%2Bmangrove%2Bwetland.&journal=Microb.+Ecol.&volume=66&pages=96-104)\n- 27\n  KajiI.AkibaY.KonnoK.WatanabeM.KimuraS.IwanagaT. (2016). Neural FFA3 activation inversely regulates anion secretion evoked by nicotinic ACh receptor activation in rat.**J. Physiol.**5943339–3352. 10.1113\/JP271441\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/26854275)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/JP271441)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=I..%2BKaji&author=Y..%2BAkiba&author=K..%2BKonno&author=M..%2BWatanabe&author=S..%2BKimura&author=T..%2BIwanaga&publication_year=2016&title=Neural%2BFFA3%2Bactivation%2Binversely%2Bregulates%2Banion%2Bsecretion%2Bevoked%2Bby%2Bnicotinic%2BACh%2Breceptor%2Bactivation%2Bin%2Brat.&journal=J.+Physiol.&volume=594&pages=3339-3352)\n- 28\n  KamphuisJ. B. J.GuiardB.LevequeM.OlierM.JouaninI.YvonS.et al (2019). Lactose and fructo-ligosaccharides increase visceral sensitivity in mice via glycation processes, increasing mast cell density in colonic mucosa.**Gastroenterology**158652–663.e6. 10.1053\/j.gastro.2019.10.037652663e6\n  \n  - [CrossRef](https:\/\/doi.org\/10.1053\/j.gastro.2019.10.037652663e6)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J.%2BB.%2BJ..%2BKamphuis&author=B..%2BGuiard&author=M..%2BLeveque&author=M..%2BOlier&author=I..%2BJouanin&author=S..%2BYvon&publication_year=2019&title=Lactose%2Band%2Bfructo-ligosaccharides%2Bincrease%2Bvisceral%2Bsensitivity%2Bin%2Bmice%2Bvia%2Bglycation%2Bprocesses%2C%2Bincreasing%2Bmast%2Bcell%2Bdensity%2Bin%2Bcolonic%2Bmucosa.&journal=Gastroenterology&volume=158&pages=652-663.e6)\n- 29\n  KiratD.KondoK.ShimadaR.KatoS. (2009). Dietary pectin up-regulates monocaboxylate transporter1 in the rat gastrointestinal tract.**Exp. Physiol.**94422–433. 10.1113\/expphysiol.2009.046797\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/19168540)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/expphysiol.2009.046797)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=D..%2BKirat&author=K..%2BKondo&author=R..%2BShimada&author=S..%2BKato&publication_year=2009&title=Dietary%2Bpectin%2Bup-regulates%2Bmonocaboxylate%2Btransporter1%2Bin%2Bthe%2Brat%2Bgastrointestinal%2Btract.&journal=Exp.+Physiol.&volume=94&pages=422-433)\n- 30\n  KunzelmannK.MallM. (2002). Electrolyte transport in the mammalian colon: mechanisms and implications for disease.**Physiol Rev.**82245–289. 10.1152\/physrev.00026.2001\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/11773614)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/physrev.00026.2001)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=K..%2BKunzelmann&author=M..%2BMall&publication_year=2002&title=Electrolyte%2Btransport%2Bin%2Bthe%2Bmammalian%2Bcolon%3A%2Bmechanisms%2Band%2Bimplications%2Bfor%2Bdisease.&journal=Physiol+Rev.&volume=82&pages=245-289)\n- 31\n  KuwaharaA.KuwaharaY.InuiT.MarunakaY. (2018). Regulation of ion transport in the intestine by free fatty acid receptor 2 and 3: possible involvement of the diffuse chemosensory system.**Int. J. Mol. Sci.**19:735. 10.3390\/ijms19030735\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/29510573)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/ijms19030735)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BKuwahara&author=Y..%2BKuwahara&author=T..%2BInui&author=Y..%2BMarunaka&publication_year=2018&title=Regulation%2Bof%2Bion%2Btransport%2Bin%2Bthe%2Bintestine%2Bby%2Bfree%2Bfatty%2Bacid%2Breceptor%2B2%2Band%2B3%3A%2Bpossible%2Binvolvement%2Bof%2Bthe%2Bdiffuse%2Bchemosensory%2Bsystem.&journal=Int.+J.+Mol.+Sci.&volume=19)\n- 32\n  LaffinM.FedorakR.ZalaskyA.ParkH.GillA.AgrawalA. (2019). A high-sugar diet rapidly enhances susceptibility to colitis via depletion of luminal short-chainfatty acids in mice.**Sci. Rep.**9:12294. 10.1038\/s41598-019-48749-2\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/31444382)\n  - [CrossRef](https:\/\/doi.org\/10.1038\/s41598-019-48749-2)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=M..%2BLaffin&author=R..%2BFedorak&author=A..%2BZalasky&author=H..%2BPark&author=A..%2BGill&author=A..%2BAgrawal&publication_year=2019&title=A%2Bhigh-sugar%2Bdiet%2Brapidly%2Benhances%2Bsusceptibility%2Bto%2Bcolitis%2Bvia%2Bdepletion%2Bof%2Bluminal%2Bshort-chainfatty%2Bacids%2Bin%2Bmice.&journal=Sci.+Rep.&volume=9)\n- 33\n  LawrenceJ. V.FischerJ. E.SuttonT. S.WeiserH. H. (1956). Adaptation of the rat to a higher lactose diet, effect of the size of the cecum.**Ohio J. Sci.**5687–92.\n  \n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J.%2BV..%2BLawrence&author=J.%2BE..%2BFischer&author=T.%2BS..%2BSutton&author=H.%2BH..%2BWeiser&publication_year=1956&title=Adaptation%2Bof%2Bthe%2Brat%2Bto%2Ba%2Bhigher%2Blactose%2Bdiet%2C%2Beffect%2Bof%2Bthe%2Bsize%2Bof%2Bthe%2Bcecum.&journal=Ohio+J.+Sci.&volume=56&pages=87-92)\n- 34\n  LiuzziJ. P.HeviaP. (1998). In well-fed young rats, lactose-induced chronic diarrhea reduces the apparent absorption of vitamins A and E and affects preferentially vitamin E status.**J. Nutr.**1282467–2472. 10.1093\/jn\/128.12.2467\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/9868195)\n  - [CrossRef](https:\/\/doi.org\/10.1093\/jn\/128.12.2467)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J.%2BP..%2BLiuzzi&author=P..%2BHevia&publication_year=1998&title=In%2Bwell-fed%2Byoung%2Brats%2C%2Blactose-induced%2Bchronic%2Bdiarrhea%2Breduces%2Bthe%2Bapparent%2Babsorption%2Bof%2Bvitamins%2BA%2Band%2BE%2Band%2Baffects%2Bpreferentially%2Bvitamin%2BE%2Bstatus.&journal=J.+Nutr.&volume=128&pages=2467-2472)\n- 35\n  MuschM. W.BooksteinC.XieY.SellinJ. H.ChangE. B. (2001). SCFA increase intestinal Na absorption by induction of NHE3 in rat colon and human intestinal C2\/bbe cells.**Am. J. Physiol. Gastrointest. Liver Physiol.**280G687–G693. 10.1152\/ajpgi.2001.280.4.G687\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/11254495)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/ajpgi.2001.280.4.G687)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=M.%2BW..%2BMusch&author=C..%2BBookstein&author=Y..%2BXie&author=J.%2BH..%2BSellin&author=E.%2BB..%2BChang&publication_year=2001&title=SCFA%2Bincrease%2Bintestinal%2BNa%2Babsorption%2Bby%2Binduction%2Bof%2BNHE3%2Bin%2Brat%2Bcolon%2Band%2Bhuman%2Bintestinal%2BC2%2Fbbe%2Bcells.&journal=Am.+J.+Physiol.+Gastrointest.+Liver+Physiol.&volume=280&pages=G687-G693)\n- 36\n  RitzhauptA.WoodI. S.EllisA.HosieK. B.Shirazi-BeecheyS. P. (1998). Identification and characterization of a monocarboxylate transporter (MCT1) in pig and human colon: its potential to transport L-lactate as well as butyrate.**J. Physiol.**513(Pt 3)719–732. 10.1111\/j.1469-7793.1998.719ba.x\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/9824713)\n  - [CrossRef](https:\/\/doi.org\/10.1111\/j.1469-7793.1998.719ba.x)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BRitzhaupt&author=I.%2BS..%2BWood&author=A..%2BEllis&author=K.%2BB..%2BHosie&author=S.%2BP..%2BShirazi-Beechey&publication_year=1998&title=Identification%2Band%2Bcharacterization%2Bof%2Ba%2Bmonocarboxylate%2Btransporter%2B%28MCT1%29%2Bin%2Bpig%2Band%2Bhuman%2Bcolon%3A%2Bits%2Bpotential%2Bto%2Btransport%2BL-lactate%2Bas%2Bwell%2Bas%2Bbutyrate.&journal=J.+Physiol.&volume=513%28Pt+3%29&pages=719-732)\n- 37\n  SivaprakasamS.BhutiaY. D.YangS.GanapathyV. (2017). Short-chain fatty acid transporters: role in colonic homeostasis.**Compr. Physiol.**8299–314. 10.1002\/cphy.c170014\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/29357130)\n  - [CrossRef](https:\/\/doi.org\/10.1002\/cphy.c170014)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=S..%2BSivaprakasam&author=Y.%2BD..%2BBhutia&author=S..%2BYang&author=V..%2BGanapathy&publication_year=2017&title=Short-chain%2Bfatty%2Bacid%2Btransporters%3A%2Brole%2Bin%2Bcolonic%2Bhomeostasis.&journal=Compr.+Physiol.&volume=8&pages=299-314)\n- 38\n  SubramanyaS. B.RajendranV. M.SrinivasanP.NandaK. N. S.BinderH. J. (2007). Differential regulation of cholera toxin-inhibited Na-H exchange isoforms by butyrate in rat ileum.**Am. J. Physiol. Gastrointest. Liver. Physiol.**293G857–G863. 10.1152\/ajpgi.00462.2006\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/17690171)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/ajpgi.00462.2006)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=S.%2BB..%2BSubramanya&author=V.%2BM..%2BRajendran&author=P..%2BSrinivasan&author=K.%2BN.%2BS..%2BNanda&author=H.%2BJ..%2BBinder&publication_year=2007&title=Differential%2Bregulation%2Bof%2Bcholera%2Btoxin-inhibited%2BNa-H%2Bexchange%2Bisoforms%2Bby%2Bbutyrate%2Bin%2Brat%2Bileum.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=293&pages=G857-G863)\n- 39\n  SwagertyD. L.Jr.WallingA. D.KleinR. M. (2002). Lactose intolerance.**Am. Fam. Physician.**651845–1850.\n  \n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=D.%2BL..%2BSwagerty&author=A.%2BD..%2BWalling&author=R.%2BM..%2BKlein&publication_year=2002&title=Lactose%2Bintolerance.&journal=Am.+Fam.+Physician.&volume=65&pages=1845-1850)\n- 40\n  SzilagyiA. (2015). Adaptation to lactose in lactase non persistent people: Effects on intolerance and the relationship between Dairy Food consumption and evalution of diseases.**Nutrients**76751–6779. 10.3390\/nu7085309\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/26287234)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/nu7085309)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BSzilagyi&publication_year=2015&title=Adaptation%2Bto%2Blactose%2Bin%2Blactase%2Bnon%2Bpersistent%2Bpeople%3A%2BEffects%2Bon%2Bintolerance%2Band%2Bthe%2Brelationship%2Bbetween%2BDairy%2BFood%2Bconsumption%2Band%2Bevalution%2Bof%2Bdiseases.&journal=Nutrients&volume=7&pages=6751-6779)\n- 41\n  TanJ.McKenzieC.PotamitisM.ThorburnA. N.MackayC. R.MaciaL. (2014). The role of short-chain fatty acids in health and disease.**Adv. Immunol.**12191–119. 10.1016\/B978-0-12-800100-4.00003-9\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/24388214)\n  - [CrossRef](https:\/\/doi.org\/10.1016\/B978-0-12-800100-4.00003-9)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J..%2BTan&author=C..%2BMcKenzie&author=M..%2BPotamitis&author=A.%2BN..%2BThorburn&author=C.%2BR..%2BMackay&author=L..%2BMacia&publication_year=2014&title=The%2Brole%2Bof%2Bshort-chain%2Bfatty%2Bacids%2Bin%2Bhealth%2Band%2Bdisease.&journal=Adv.+Immunol.&volume=121&pages=91-119)\n- 42\n  ThaparN.SandersonI. R. (2004). Diarrhoea in children: an interface between developing and developed countries.**Lancet**363641–653. 10.1016\/S0140-6736(04)15599-2\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/S0140-6736\\(04\\)15599-2)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=N..%2BThapar&author=I.%2BR..%2BSanderson&publication_year=2004&title=Diarrhoea%2Bin%2Bchildren%3A%2Ban%2Binterface%2Bbetween%2Bdeveloping%2Band%2Bdeveloped%2Bcountries.&journal=Lancet&volume=363&pages=641-653)\n- 43\n  van de HeijningB. J.SchipperL.VoogdE.OostingA.van der BeekE. M. (2015). Acute and chronic effects of dietary lactose in adult rats are not explained by residual intestinal lactase activity.**Nutrients**75542–5555. 10.3390\/nu7075237\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/26184291)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/nu7075237)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=B.%2BJ..%2Bvan%2Bde%2BHeijning&author=L..%2BSchipper&author=E..%2BVoogd&author=A..%2BOosting&author=E.%2BM..%2Bvan%2Bder%2BBeek&publication_year=2015&title=Acute%2Band%2Bchronic%2Beffects%2Bof%2Bdietary%2Blactose%2Bin%2Badult%2Brats%2Bare%2Bnot%2Bexplained%2Bby%2Bresidual%2Bintestinal%2Blactase%2Bactivity.&journal=Nutrients&volume=7&pages=5542-5555)\n- 44\n  VidyasagarS.RamakrishnaB. S. (2002). Effects of butyrate on active sodium and chloride transport in rat and rabbit distal colon.**J. Physiol.**539(Pt 1)163–173. 10.1113\/jphysiol.2001.013056\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/11850510)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/jphysiol.2001.013056)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=S..%2BVidyasagar&author=B.%2BS..%2BRamakrishna&publication_year=2002&title=Effects%2Bof%2Bbutyrate%2Bon%2Bactive%2Bsodium%2Band%2Bchloride%2Btransport%2Bin%2Brat%2Band%2Brabbit%2Bdistal%2Bcolon.&journal=J.+Physiol.&volume=539%28Pt+1%29&pages=163-173)\n- 45\n  WalkerN. M.SimpsonJ. E.YenP. F.GillR. K.RigsbyE. V.BrazillJ. M. (2008). Down-regulated in adenoma Cl\/HCO3 exchanger couples with Na\/H exchanger 3 for NaCl absorptionin murine small intestine.**Gastroenterology**1351645–1653.\n  \n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=N.%2BM..%2BWalker&author=J.%2BE..%2BSimpson&author=P.%2BF..%2BYen&author=R.%2BK..%2BGill&author=E.%2BV..%2BRigsby&author=J.%2BM..%2BBrazill&publication_year=2008&title=Down-regulated%2Bin%2Badenoma%2BCl%2FHCO3%2Bexchanger%2Bcouples%2Bwith%2BNa%2FH%2Bexchanger%2B3%2Bfor%2BNaCl%2Babsorptionin%2Bmurine%2Bsmall%2Bintestine.&journal=Gastroenterology&volume=135&pages=1645-1653)\n- 46\n  WangY.ShengH. F.HeY.WuJ. Y.JiangY. X.TamN. F. (2012). Comparison of the levels of bacterial diversity in fresh water, intertidal wetland, and marine sediments by using millions of Illumina Tags.**Appl. Environ. Microbiol.**78:8264. 10.1128\/AEM.01821-12\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23001654)\n  - [CrossRef](https:\/\/doi.org\/10.1128\/AEM.01821-12)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=Y..%2BWang&author=H.%2BF..%2BSheng&author=Y..%2BHe&author=J.%2BY..%2BWu&author=Y.%2BX..%2BJiang&author=N.%2BF..%2BTam&publication_year=2012&title=Comparison%2Bof%2Bthe%2Blevels%2Bof%2Bbacterial%2Bdiversity%2Bin%2Bfresh%2Bwater%2C%2Bintertidal%2Bwetland%2C%2Band%2Bmarine%2Bsediments%2Bby%2Busing%2Bmillions%2Bof%2BIllumina%2BTags.&journal=Appl.+Environ.+Microbiol.&volume=78)\n- 47\n  WardlawT.SalamaP.BrocklehurstC.ChopraM.MasonE. (2010). Diarrhoea: why children are still dying and what can be done.**Lancet**375870–872. 10.1016\/S0140-6736(09)61798-0\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/S0140-6736\\(09\\)61798-0)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T..%2BWardlaw&author=P..%2BSalama&author=C..%2BBrocklehurst&author=M..%2BChopra&author=E..%2BMason&publication_year=2010&title=Diarrhoea%3A%2Bwhy%2Bchildren%2Bare%2Bstill%2Bdying%2Band%2Bwhat%2Bcan%2Bbe%2Bdone.&journal=Lancet&volume=375&pages=870-872)\n- 48\n  WindeyK.HoubenE.DerooverL.VerbekeK. (2015). Contribution of colonic fermentation and fecal water toxicity to the pathophysiology of lactose-intolerance.**Nutrients**77505–7522. 10.3390\/nu7095349\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/26371036)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/nu7095349)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=K..%2BWindey&author=E..%2BHouben&author=L..%2BDeroover&author=K..%2BVerbeke&publication_year=2015&title=Contribution%2Bof%2Bcolonic%2Bfermentation%2Band%2Bfecal%2Bwater%2Btoxicity%2Bto%2Bthe%2Bpathophysiology%2Bof%2Blactose-intolerance.&journal=Nutrients&volume=7&pages=7505-7522)\n- 49\n  XueH.TianY. M.YanM.YangN.XingY.et al (2007). Appearance of segmental discrepancy of anion transport in rat distal colon.**Biol. Pharm. Bull.**301407–1411. 10.1248\/bpb.30.1407\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/17666794)\n  - [CrossRef](https:\/\/doi.org\/10.1248\/bpb.30.1407)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H..%2BXue&author=Y.%2BM..%2BTian&author=M..%2BYan&author=N..%2BYang&author=Y..%2BXing&publication_year=2007&title=Appearance%2Bof%2Bsegmental%2Bdiscrepancy%2Bof%2Banion%2Btransport%2Bin%2Brat%2Bdistal%2Bcolon.&journal=Biol.+Pharm.+Bull.&volume=30&pages=1407-1411)\n- 50\n  YajimaT.InoueR.MatsumotoM.YajimaM. (2011). Non-neuronal release of ACh plays a key role in secretory response to luminal propionate in rat colon.**J. Physiol.**589(Pt 4)953–962. 10.1113\/jphysiol.2010.199976\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/21135046)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/jphysiol.2010.199976)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T..%2BYajima&author=R..%2BInoue&author=M..%2BMatsumoto&author=M..%2BYajima&publication_year=2011&title=Non-neuronal%2Brelease%2Bof%2BACh%2Bplays%2Ba%2Bkey%2Brole%2Bin%2Bsecretory%2Bresponse%2Bto%2Bluminal%2Bpropionate%2Bin%2Brat%2Bcolon.&journal=J.+Physiol.&volume=589%28Pt+4%29&pages=953-962)\n- 51\n  ZhaiS.ZhuL.QinS.LiL. (2018). Effect of lactulose intervention on gut microbiota and short chain fatty acid composition of C57BL\/6J mice.**Microbiologyopen**7:e00612. 10.1002\/mbo3.612\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/29575825)\n  - [CrossRef](https:\/\/doi.org\/10.1002\/mbo3.612)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=S..%2BZhai&author=L..%2BZhu&author=S..%2BQin&author=L..%2BLi&publication_year=2018&title=Effect%2Bof%2Blactulose%2Bintervention%2Bon%2Bgut%2Bmicrobiota%2Band%2Bshort%2Bchain%2Bfatty%2Bacid%2Bcomposition%2Bof%2BC57BL%2F6J%2Bmice.&journal=Microbiologyopen&volume=7)\n\n## Summary\nKeywords\n\nlactose, diarrhea, microbiota, SCFA, Na\\+\n\nCitation\n\nXue H, Zhang M, Ma J, Chen T, Wang F and Tang X (2020) Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon. *Front. Physiol.* 11:877. doi: [10\\.3389\/fphys.2020.00877](http:\/\/dx.doi.org\/10.3389\/fphys.2020.00877)\n\nReceived\n\n04 March 2020\n\nAccepted\n\n29 June 2020\n\nPublished\n\n29 July 2020\n\nVolume\n\n11 - 2020\n\nEdited by\n\nKusum K. Kharbanda, University of Nebraska Medical Center, United States\n\nReviewed by\n\nWaddah Alrefai, University of Illinois at Chicago, United States; Shubha Priyamvada, University of Illinois at Chicago, United States\n\nUpdates\n\n![Crossmark icon](https:\/\/www.frontiersin.org\/ap-2024\/images\/crossmark_color.webp)\n\nCheck for updates\n\nCopyright\n\n© 2020 Xue, Zhang, Ma, Chen, Wang and Tang.\n\nThis is an open-access article distributed under the terms of the [Creative Commons Attribution License (CC BY)](http:\/\/creativecommons.org\/licenses\/by\/4.0\/). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\n\n**\\***Correspondence:**** Hong Xue, [xuehong03@163.com](mailto:xuehong03@163.com); Fengyun Wang, [wfy811@163.com](mailto:wfy811@163.com); Xudong Tang, [txdly@sina.com.cn](mailto:txdly@sina.com.cn); [txdly@sina.com](mailto:txdly@sina.com)\n\nThis article was submitted to Gastrointestinal Sciences, a section of the journal Frontiers in Physiology\n\nDisclaimer\n\nAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.\n\n### Editor & Reviewers\nEdited by\n\n[KKKusum K. Kharbanda University of Nebraska Medical Center, United States](https:\/\/loop.frontiersin.org\/people\/470144)\n\nReviewed by\n\n[SPShubha Priyamvada University of Illinois Chicago, United States](https:\/\/loop.frontiersin.org\/people\/724377)\n\n[WAWaddah Alrefai University of Illinois Chicago, United States](https:\/\/loop.frontiersin.org\/people\/935581)\n\nFrontiers' quality\n\n## How do we build trust in science?\nBehind each Frontiers journal is an editorial board committed to upholding research integrity and scientific quality\n\n[Learn more](https:\/\/www.frontiersin.org\/about\/quality)\n\n[Published inFrontiers in Physiology Gastrointestinal Sciences**3\\.4** impact factor **7\\.3** citescore](https:\/\/www.frontiersin.org\/journals\/physiology)\n\nArticle metrics\n\n[View details](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#metrics)\n\n[Download PDF](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/pdf)\n\nDownload other formats\n\n- [ReadCube](http:\/\/www.readcube.com\/articles\/10.3389\/fphys.2020.00877)\n- [EPUB](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/epub)\n- [XML](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/xml)\n\nCite article\n\nShare article\n\n- [PDF](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/pdf)\n  Download other format\n  \n  - [ReadCube](http:\/\/www.readcube.com\/articles\/10.3389\/fphys.2020.00877)\n  - [EPUB](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/epub)\n  - [XML](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/xml)\n- [Outline](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#outline)\n- [Figures](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#figures)\n- [Cite](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#cite)\n- [Share](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#share)\n- [Metrics](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#metrics)\n- [Suppl. material](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#supplementaryMaterial)\n\n- [Abstract](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#h1)\n- [Introduction](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#S1)\n- [Materials and Methods](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#S2)\n- [Results](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#S3)\n- [Data availability statement](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#h5)\n- [Ethics statement](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#h6)\n- [Author contributions](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#h7)\n- [Funding](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#h8)\n- [Acknowledgments](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#h9)\n- [Conflict of interest](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#h10)\n- [Supplementary material](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#S9)\n- [References](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#h12)\n\nFigures and Tables\n\n- FIGURE 1\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g001.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F1)\n- FIGURE 2\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g002.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2)\n- FIGURE 3\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g003.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F3)\n- FIGURE 4\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g004.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4)\n- FIGURE 5\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g005.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F5)\n- FIGURE 6\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g006.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F6)\n- FIGURE 7\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g007.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)\n- FIGURE 8\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g008.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F8)\n- FIGURE 9\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g009.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F9)\n- FIGURE 10\n  ![](https:\/\/www.frontiersin.org\/files\/Articles\/540252\/xml-images\/fphys-11-00877-g010.webp)\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F10)\n- TABLE 1\n  Comparison of the severity of diarrhea after single high lactose (30 or 40%) or incremental high lactose diet (30%\/40%\/50%) feeding for 3 weeks.\n  [View in article](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#T1)\n\nCopy to clipboard\n\nCitation\n\nCopy citation\n\nExport citation file\n\n- [BibTex](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/bibTex)\n- [EndNote](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/endNote)\n- [Reference Manager](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/reference)\n- [Simple Text file](https:\/\/public-pages-files-2025.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/text)\n\n- [Facebook](https:\/\/www.facebook.com\/sharer\/sharer.php?u=https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full)\n- [X](https:\/\/www.twitter.com\/share?url=https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full)\n- [LinkedIn](https:\/\/www.linkedin.com\/share?url=https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full)\n- [Email](<mailto:?subject=Interesting science article: Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon&body=Hi!!%0D%0A%0D%0AI think you might find interesting the article \"Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon\".%0D%0A%0D%0AYou can read more about it here: https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full>)\n- [WeChat]()\n\n- Table 1.XLS\n- Data Sheet 1.PDF\n- Image 1.TIF\n\n- Guidelines\n  - [Author guidelines](https:\/\/www.frontiersin.org\/guidelines\/author-guidelines)\n  - [Services for authors](https:\/\/www.frontiersin.org\/for-authors\/author-services)\n  - [Policies and publication ethics](https:\/\/www.frontiersin.org\/guidelines\/policies-and-publication-ethics)\n  - [Editor guidelines](https:\/\/www.frontiersin.org\/guidelines\/editor-guidelines)\n  - [Fee policy](https:\/\/www.frontiersin.org\/about\/fee-policy)\n- Explore\n  - [Articles](https:\/\/www.frontiersin.org\/articles)\n  - [Research Topics](https:\/\/www.frontiersin.org\/research-topics)\n  - [Journals](https:\/\/www.frontiersin.org\/journals)\n  - [How we publish](https:\/\/www.frontiersin.org\/about\/how-we-publish)\n- Outreach\n  - [Frontiers Forum](https:\/\/forum.frontiersin.org\/)\n  - [Frontiers Policy Labs](https:\/\/policylabs.frontiersin.org\/)\n  - [Frontiers for Young Minds](https:\/\/kids.frontiersin.org\/)\n  - [Frontiers Planet Prize](https:\/\/www.frontiersin.org\/about\/frontiers-planet-prize)\n- Connect\n  - [Help center](https:\/\/helpcenter.frontiersin.org\/)\n  - [Emails and alerts](https:\/\/subscription-management.frontiersin.org\/emails\/preferences#block0)\n  - [Contact us](https:\/\/www.frontiersin.org\/about\/contact)\n  - [Submit](https:\/\/www.frontiersin.org\/submission\/submit)\n  - [Career opportunities](https:\/\/careers.frontiersin.org\/)\n\nFollow us\n\n© 2026 Frontiers Media SA. All rights reserved.\n\n[Privacy policy](https:\/\/www.frontiersin.org\/legal\/privacy-policy) \\| [Terms and conditions](https:\/\/www.frontiersin.org\/legal\/terms-and-conditions) \\| [Accessibility statement](https:\/\/www.frontiersin.org\/about\/accessibility-statement)\n\nShare on WeChat\n\nScan with WeChat to share this article","attrs_readable_markdown":"## Abstract\nDiarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the epithelial ion transport in lactose-induced diarrhea remain unclear. The present study aimed to investigate the effect of an incremental high-lactose diet (IHLD, 30%\/40%\/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. Gut microbiota were analyzed by 16S rRNA amplicon sequencing and the concentration of SCFAs by gas chromatography, galactose, lactose and lactic acid through assay kit; Ussing chamber was performed to detect basal and stimulated ion transport; The expression and location of SCFA transporters, the Na-H exchanger 3(NHE3), cystic fibrosis transporter regulater (CFTR) and NKCC1 in the colon mucosa were analyzed by western and immunostaining. The concentrations of lactose, galactose and lactic acid of the cecal content were markedly increased (*P* \\< 0.01) and SCFA concentration was significantly decreased (*P* \\< 0.01). This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and increased relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. The expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels, and decreases in delta basal short circuit current after apical Na\\+ removal in the colonic mucosa of the IHLD group contributed to Na\\+ accumulation in the lumen and decrease stimulated Cl– secretion with low CFTR and NKCC1 expression would compensate for water and electrolyte loss during the diarrhea process. These results indicated that the persistence of the diarrhea state was maintained by abnormal colonic microbiota fermentation leading to high concentrations of lactose, galactose and lactic acid and low SCFAs in the lumen, and decreased Na\\+ absorption with the low NHE3 expression and phosphorylation levels.\n\n## Introduction\nDiarrhea is a highly prevalent and bothersome disorder, particularly in children and the elderly. According to the WHO, it is estimated that 577,000 children aged \\<5 years and 502,000 adults aged \\>70 years will die from diarrheal diseases worldwide ([Thapar and Sanderson, 2004](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B42); [Bryce et al., 2005](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B11); [Wardlaw et al., 2010](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B47)). Long-standing diarrhea causes malnutrition, which in turn leads to more difficulty in treating. Approximately 70% of the world’s population has hypolactasia after weaning, resulting in lactose malabsorption or lactose intolerance, defined as the presence of gastrointestinal symptoms such as bloating, rumbling, abdominal pain, nausea and diarrhea ([Swagerty et al., 2002](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B39); [Bayless et al., 2017](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B4); [Fassio et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B17)).\n\nAs we know, lactose intolerance-induced diarrhea belongs to osmotic diarrhea, thereby resulting in colonic water and electrolyte accumulation ([Hammer and Hammer, 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B20)). It is believed that the osmotic load is not only caused by undigested lactose but that the colonic fermentation capacity plays a role in lactose intolerance ([He et al., 2006](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B22)). Lactose is fermented by the colonic resident microbiota into a series of intermediate and end-product metabolites, including lactate, formate, succinate and short-chain fatty acids (SCFAs), including acetate, propionate and butyrate ([He et al., 2006](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B22); [Windey et al., 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B48)). Some reports have indicated that the osmolality of lactose-induced diarrhea is closely linked to the lactose content and the production of SCFAs in the colon ([Binder, 2010](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B5); [Alexandre et al., 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B2)). SCFAs are the main anions of the colon, which have been demonstrated to be novel regulators of colonic ion transport ([Yajima et al., 2011](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B50); [Kaji et al., 2016](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B27)). Therefore, we speculated that the mechanism of lactose-induced diarrhea involved a change in SCFAs or lactate leading to a disturbance in colonic epithelial ion transport resulting in diarrhea. In the process of the transport of SCFAs, monocarboxylate (MCT1) and sodium MCT1 (sMCT1) transporters play an important role in mediating SCFA influx into the blood from the lumen ([Ritzhaupt et al., 1998](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B36); [Ganapathy et al., 2005](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B19); [Sivaprakasam et al., 2017](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B37)).\n\nIt is commonly recognized that diarrhea results from excessive secretion and\/or impaired absorption of fluid and electrolytes across the intestinal epithelium. Excessive fluid secretion is caused by active chloride secretion into the intestinal lumen, which drives secondary movement of sodium and water ([Binder et al., 1991](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B7); [Hoque et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B23)). Chloride secretion involves the activation of chloride channel(s), such as CFTR, on the apical plasma membrane, and it is transported into the cell at the basolateral membrane by a Na\/K\/Cl symporter (NKCC1, also known as SLC12A2) ([Kunzelmann and Mall, 2002](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B30)). Na\\+ absorption includes electrogenic Na\\+ absorption mediated by epithelial Na\\+ channels (ENaC), whereas electroneutral Na\\+ absorption is mediated by the Na-H exchanger (NHE) and Cl–\\-HCO3 \\- exchanger (an anion exchanger; AE) ([Binder et al., 1987](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B6)). NHE3 mediates both HCO3\\-dependent and butyrate-dependent Na\\+ absorption in the normal gut, which is regulated by butyrate ([Subramanya et al., 2007](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B38)), inducing NHE3 expression and increasing Na\\+ absorption in the rat colon ([Musch et al., 2001](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B35); [Vidyasagar and Ramakrishna, 2002](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B44)).\n\nAlthough some studies demonstrated that undigested lactose and SCFAs induce diarrhea secondary to osmotically induced accumulation of ions and water in the colon ([Christopher and Bayless, 1971](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B12); [Hammer et al., 1989](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B21)), the change in the large intestinal luminal environment and disorder of the epithelial ion transport mechanism of lactose-induced chronic diarrhea remained unclear. Therefore, the objective of the study was to investigate the effect of an incremental high-lactose diet (IHLD, 30%\/40%\/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbiota and Na\\+ absorption.\n\n## Materials and Methods\n### Animals and Diarrhea Induction Using an Incremental High Lactose Diet\nThe experimental procedures followed the guidelines and practices of the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). The procedures were conducted in accordance with the Beijing Administration Office Committee of Laboratory Animals. Male Wistar rats (350–400 g) were housed under an artificial 12 h light-12 dark cycle (lights on at 08:00 h). Forty rats were fed a standard chow diet *ad libitum* and had free access to water for 4 days prior to the induction of diarrhea. Then, all rats were randomly divided into 4 groups of 10 animals each. The control group was fed a standard chow diet; the 30% lactose group was fed 30% lactose for 3 weeks; the 40% lactose group was fed 40% lactose for 3 weeks; and the IHLD group was fed 30–40–50% IHLD, which consisted of 30% lactose for the first week, 40% lactose for the second week and 50% lactose for the third week ([Figure 1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F1)). An IHLD containing 30, 40, and 50% lactose in place of starch was fed to rats (Keao Xieli Feed Co Ltd., Beijing). Rats were monitored for changes in the consistency of pellets and stool mass and fecal fluid. Rats were considered diarrheic if they produced watery, soft, yellowish stools compared to normal, pliable, soft, well-formed pellets as previously described by other researchers ([Boakye et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B8)).\n\nFIGURE 1\n\n### DNA Extraction and PCR Amplification\nCecal microbiota DNA was extracted using the Omega Stool DNA Kit (Qiagen, United States) and applied to amplification of the V3-V4 region of 16S rDNA with the gene-specific primers ACTCCTACGGGAGGCAGCAG and GGACTACHVGGGTWTCTAAT.PCR reactions were performed on a Mastercycler Gradient (Eppendorf, Germany) using 25 μl reaction volumes containing 12.5 μl of 2× Taq Plus Master Mix, 1 μl of forward primer (5 μM), 1 μl of reverse primer (5 μM), 3 μL of BSA (2 ng\/μL), 5 μl of DNA (total template quantity is 30 ng), and 2.5 μl of ddH2O. PCR amplification was as follows: initiation at 94°C for 5 min, followed by 28 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, with a final extension of 72°C for 7 min. Three PCR products per sample were pooled to mitigate reaction-level PCR biases. The PCR products were purified using a QIAquick Gel Extraction Kit (QIAGEN, Germany), quantified using Real Time PCR, and sequenced at Allwegene Company, Beijing.\n\n### High-Throughput Sequencing\nDeep sequencing was performed on the MiSeq platform at Allwegene Company (Beijing). After the run, image analysis, base calling and error estimation were performed using Illumina Analysis Pipeline Version 2.6.\n\n### Data Analyses\nThe raw data were first screened, and sequences were removed from consideration if they were shorter than 200 bp, had a low quality score (≤20), contained ambiguous bases or did not exactly match primer sequences and barcode tags. Qualified reads were separated using the sample-specific barcode sequences and trimmed with Illumina Analysis Pipeline Version 2.6. Then, the dataset was analyzed using QIIME. The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97% ([Edgar, 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B16)) to generate rarefaction curves and to calculate the richness and diversity indices. The Ribosomal Database Project (RDP) Classifier tool was used to classify all sequences into different taxonomic groups ([Cole et al., 2009](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B14)).\n\nTo examine the similarity between different samples, clustering analyses and PCA were used based on the OTU information from each sample using R ([Wang et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B46)). The evolution distances between microbial communities from each sample were calculated using the tayc coefficient and represented as an Unweighted Pair Group Method with Arithmetic Mean (UPGMA) clustering tree describing the dissimilarity (1-similarity) between multiple samples ([Jiang et al., 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B26)). A Newick-formatted tree file was generated through this analysis. To compare the membership and structure of communities in different samples, heat maps were generated with the top 20 OTUs using Mothur ([Jami et al., 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B25)).\n\n### SCFA, Lactose, Galactose and Lactic Acid Quantity\nThe cecal contents were simply sampled in sterile tubes. Samples were kept frozen at −80°C until analysis. The samples were removed from the freezer, and 1,200 μL of water was added to each thawed sample. The samples were vortexed for 1 min until the material was homogenized. The SCFA content was determined by gas chromatography. Chromatographic analysis was carried out using an Agilent GC system with a flame ionization detector (FID) (Shimadzu Corp, Kyoto, Japan). Fused silica capillary columns 30 m × 0.25 mm coated with 0.25 μm film thickness were used. Nitrogen was used as the carrier gas. The oven temperature was 250°C, and the FID and injection port were set to 300 and 250°C, respectively. The injected sample volume was 1 μL, and the run time for each analysis was 32 min. The chromatograms and data integration were carried out using a Shimadzu C-R5A Chromatopac. The method was performed according to reference ([David et al., 2014](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B15)).\n\nLactose, galactose and lactic acid were detected by corresponding assay kits (ELAC-100, EGAL-100 and ECLC-100, respectively, Bioassay Systems, Hayward, CA, United States) according to the instructions. An aliquot of 50 mg of cecal and proximal colon content samples was dissolved in deionized water, vortexed for 20 s and centrifuged at 12,000 × *g* for 10 min at 4°C. The supernatant was eluted from HLB cartridges and evaporated to dryness under a nitrogen stream. Then, 50 μl of deionized water was added to the tube and redissolved.\n\n### Ussing Chamber Experiments\nThe distal colon was cut longitudinally along the mesenteric border. The serosa, muscularis and submucosa layers were stripped away with fine forceps to prepare a mucosa sample. Stripped mucosa was mounted in a modified Ussing Chamber in a tissue holder (Easy Mount Chamber; Physiologic Instruments, San Diego, CA, United States) with an aperture surface area of 0.3 cm2. Each sample was bathed bilaterally in Krebs-Henseleit solution (KHS). A short-circuit current was measured *in vitro* in Ussing chambers. Transepithelial PD was then clamped at 0 mV, and the short-circuit current (*I**SC*) was recorded with a VCCMC6 voltage-current clamp amplifier (Physiologic Instruments, San Diego, CA, United States). Transepithelial resistance (TR) (Ω∗cm2) was measured by altering the membrane potential in a stepwise fashion (0.1 mV) and calculated from the ohmic relationship.\n\n### Solutions and Chemicals\nKrebs-Henseleit solution (KHS) (mmol\/L): NaCl, 117; KCl, 4.7; MgCl2, 1.2; KH2PO4, 1.2; NaHCO3, 24.8; CaCl2, 2.5; and glucose, 11.1. The solution was bubbled with 95% O2 and 5% CO2 to maintain a pH value of 7.4. Na\\+ free: NMDGCl 117; KCl 4.7; MgCl2.6H2O 1.2; KH2PO3 1.2; choline HCO3 25; CaCl2.2H2O 2.56; GS 11.1.\n\nThe indomethacin, tetrodotoxin (TTX), DPC, amiloride, and forskolin, were purchased from Sigma (St. Louis, MO, United States). Stock solutions of all the above chemicals were dissolved in DMSO. The final DMSO concentration never exceeded 0.1% (v\/v). Preliminary experiments indicated that the vehicle did not alter any baseline electrophysiological parameters.\n\n### Western Blotting\nTissue samples were collected from the colon mucosa of the control and high-lactose diets. Tissues were homogenized and sonicated in cold lysis buffer with protein inhibitiors and phosphatase inhibitors (Beyotime Biotechnology, Beijing). After 30 min standing in 4°C, the samples were then centrifuged at 12,000 × *g* for 30 min at 4°C. The pellets were discarded, and the supernatant was used for blotting. The proteins (50 μg) were separated via 8 or 10% SDS\/PAGE. The blot was washed with Tris-buffered saline containing Tween-20 (TBST) and incubated overnight at 4°C with polyclonal primary antibodies against MCT1, sMCT1, NKCC1, and CFTR ([Supplementary Table S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS1)) and the rabbit polyclonal anti-actin antibody ([Supplementary Table S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS1)). After washing with TBST, the membranes were incubated with secondary antibodies ([Supplementary Table S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS1)).\n\n### Immunostaining\nThe specimens were fixed with 4% paraformaldehyde for 10 min at 25°C, rinsed three times, and incubated with blocking serum for 1 h and anti-MCT, anti-sMCT1, anti-NHE3, anti-NKCC1 and anti-CFTR antibodies overnight at 4°C. After washing with PBS, the specimens were incubated with secondary antibodies. All antibodies in the experiments were shown in the [Supplementary Material](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#FS1) ([Supplementary Table S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS1)). Images were obtained using a fluorescence microscope (Leica DM2500, Germany) with 20× or 40× dry lens.\n\n### Statistical Analyses\nAll data are presented as the mean ± SEM. Differences between three groups were evaluated using ANOVA with Prism software (version 9.1, SAS Institute, Inc.), and those between two groups were assessed using the *t*\\-test. The Wilcoxon *t*\\-test was used to compare microbial communities between two groups. Principal component analysis (PCA) plots of bacterial populations were created using Metaboanalyst 3.0. LEfSe analysis of the treatment group was performed on the basis of the results of the Wilcoxon tests, and the threshold on the logarithmic linear discriminant analysis (LDA) score was 3. Significance was defined as *P* \\< 0.05.\n\n## Results\n### Effect of IHLD-Induced Diarrhea on the Fecal Form, Fecal Fluid Content and Weight\nAfter 30% lactose administration for 48 h, we observed that the majority of rats began to produce wet, loose and yellowish stools. On the 7th day and 14th day, we changed to 40 and 50% lactose and found profuse, watery stools visibly containing lots of mucus with or without a structural pellet form ([Table 1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#T1)). Compared to 30% lactose for 3 weeks, the graded increase in the concentration of lactose avoided the adaptation of rats to lactose and exhibited considerably more diarrhea than the same concentration of 30% lactose for 3 weeks. From our data, IHLD-fed rats could induce persistent and chronic diarrhea compared with only 30 or 40% lactose for 3 weeks, which can avoid adaptation to lactose in rats ([Table 1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#T1)). In the first week, the majority of diarrheic rats (80 and 90%) showed severe diarrhea with profuse, watery stools containing mucus after 30 and 40% lactose diet. In the 3rd week, the fecal characteristics of most rats in the 30 or 40% lactose group showed loose and soft stool pellets, suggesting that diarrhea began to improve. 20% of rats in the IHLD group produced profuse, loose, wet and mucoid stools, and 40% of rats in the IHLD group produced many loose, yellowish, wet stools with or without the structural form of pellets.\n\nTABLE 1\n\n|   |   |   |   |   |   |\n|---|---|---|---|---|---|\n| Diets | Form of stool after 48 h to 21st day |   |   |   |   |\n|   | Watery diarrhea + mucous (incontinence or profuse) | Loose stools + mucous (non-structural stool) | Loose stool with structural form of pellet | Soft formed pellets | Hardened normal pellets |\n| Standard chow diet | – | – | – | \\++ | \\++++ |\n| 30% lactose diet 1st w | \\+++ | \\++ | \\+ | \\+ | – |\n| 40% lactose diet 1st w | \\++++ | \\++++ | – | – | – |\n| IHLD 1st w | \\+++ | \\++ | \\+ | \\+ | – |\n| 30% lactose diet 2nd w | – | \\+ | \\+ | \\+ | – |\n| 40% lactose diet 2nd w | \\++ | \\++ | \\++ | – | – |\n| IHLD 2rd w | \\+ | \\++ | \\+ | \\+ | – |\n| 30% lactose diet 3rd w | \\+ | – | \\++ | \\++ | \\+ |\n| 40% lactose diet | – | \\+ | \\++ | \\+ | – |\n| 3rd w IHLD 3rd w | \\+ | \\+ | \\++ | \\+ | – |\n\nComparison of the severity of diarrhea after single high lactose (30 or 40%) or incremental high lactose diet (30%\/40%\/50%) feeding for 3 weeks.\n\n*IHLD: incremental high-lactose diet 1st w: the first week, 2nd w: second week, 3rd w: third week. Qualitative assessment score or classification: – condition not observed, + is the observed once\/day; ++ is the observed twice\/day. +++ is the observed 3–4 times\/day, ++++ is the abundantly observed and +++++ is the almost exclusively observed.*\n\nThe IHLD caused a significant increase in fecal fluid content, as fluid content constituted 79% of stool mass compared with 16% in pellets produced by rats fed the standard diet ([Figure 2A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2); *P* \\< 0.001). Furthermore, IHLD significantly decreased the fecal pH value compared with that of control rats ([Figure 2B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2), *P* \\< 0.001). In addition, an IHLD significantly decreased weight ([Figure 2C](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2)), similar to previous studies ([Liuzzi and Hevia, 1998](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B34); [Boakye et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B8)). The everyday average food consumption and water intake were mildly decreased compared to those of the control group ([Figures 2D,E](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2)). The average urine volume were almost same among the four groups ([Figure 2F](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F2)).\n\nFIGURE 2\n\n### Microbial Dysbiosis After Incremental High-Lactose Diet\nIncremental high-lactose diet induced significant alterations in the composition of the luminal microbiota of the cecum by 16S rRNA-Amplicon sequencing. A total of 14 samples from the two groups were analyzed by high-throughput pyrosequencing, which generated 1,133,201 clean tags. After IHLD, the Shannon and Chao 1 indexes revealed that the diversity and richness of the microbial communities were significantly lower than those in the control group ([Figure 3A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F3)). Briefly, the results of PCA (Principal component analysis) showed that the composition of the luminal microbiota of IHLD formed a totally different cluster in the ordination plot, suggesting that IHLD caused major changes in the gut microbiome profiles ([Figure 3B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F3)).\n\nFIGURE 3\n\nUnivariate analysis (LDA effect size) was performed to identify the key phyla and genera that exhibited large alterations in microbial composition after IHLD ([Figure 4A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4)). At the phylum level, the abundance of Bacteroidetes (16.54% versus 0.029%) and Verrucomicrobia (1.01% versus 0.0036%) significantly decreased, whereas that of Proteobacteria significantly increased after IHLD (0.58% versus 6.28%) ([Figure 4B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4) and [Supplementary Table S2](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS2)). At the genus level, the abundance of 139 genera showed significant differences between the two groups. The IHLD group showed a marked increase compared to the control group in the relative abundances of Bifidobacterium (0.004% versus 1.12%), Escherichia-Shigella (0.02% versus 5.7%), Megamonas (0.23% versus 20.33%), and Lactobacillus (21.85% versus 70.85%) ([Figure 4B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4) and [Supplementary Table S2](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS2)). In contrast, the concentrations of 59 genera were decreased to zero in the IHLD group, as shown in the [Supplementary Table S2](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#TS2), including SCFA-producing bacteria such as Ruminococcaceae UCG-013 ([Figure 4C](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F4)), Lachnospiraceae UCG-001 and Lachnospiraceae FCS020 group, also including lactose-fermenting Roseburia species increased by administration of a highly purified short-chain galactooligosaccharide (GOS) ([Azcarate-Peril et al., 2017](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B3)).\n\nFIGURE 4\n\nCorrelation analyses were performed to identify the relationships between microbial genera and lactose fermentation products including lactose, galactose, lactate and SCFAs. The results showed the relative abundances of four genera, including Lactobacillus, Bifidobacterium, Megamonas and Escherichia Shigella, showing a strong relationship with lactose, galactose and lactate ([Figure 5](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F5)). Among them, the relative abundance of lactobacilli, as the best-known lactic acid-producing bacteria, was 3.3-fold higher in IHLD than in the control. Another 16 genera, especially Allobaculum, Akkermansia, Lactobacillus, Bifidobacterium, and Bacteroides, with very low relative abundances showed a close association with the concentration of SCFAs.\n\nFIGURE 5\n\n### SCFA, Lactose, Galactose and Lactic Acid Quantification in the Cecal Luminal Contents\nThe SCFA concentration is high in the cecum and proximal colon since SCFAs are produced by microbial fermentation in the cecum ([Tan et al., 2014](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B41); [Kuwahara et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B31)). Therefore, we investigated the concentration of SCFAs in the cecum. Lactose, galactose, lactic acid and SCFAs were quantified in cecal contents in the control and model groups. Interestingly, a significant decrease in the concentration of SCFAs was observed in the intestinal contents in the IHLD group in contrast to the control group. Acetate, propionate and butyrate were 140% lower in the cecum in the model group than in the control group, as presented in [Figures 6A,B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F6), suggesting that SCFA production was lower in the colon. In contrast, lactose, galactose and lactic acid concentrations were 10-, 6-, and 15-fold higher in the IHLD group, respectively than in the control group ([Figure 6C](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F6)). The results suggested that the high concentrations of lactose, lactic acid and galactose in the colon lumen but not SCFAs led to hyperosmosis in the colon, which would be the major reason for diarrhea.\n\nFIGURE 6\n\n### Expression and Location of MCT and sMCT1 in the Colon of the IHLD Group and Control Group\nMCT1 is an H\\+\\-coupled transporter expressed in the apical membrane and basolateral membrane of the colonic epithelium ([Ritzhaupt et al., 1998](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B36); [Kirat et al., 2009](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B29)), mediating SCFA influx from the lumen and SCFA efflux into the blood ([Iwanaga et al., 2006](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B24)). The western blot results showed that the expression level of MCT1 protein in the colon of the IHLD group was lower by 65% than that in the control group ([Figures 7A,B](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)). Moreover, the number and intensity of MCT1 immunopositive cells were greatly decreased in lactose-fed rats ([Figures 7E,F](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)) compared with control animals ([Figures 7C,D](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)), confirming the western blot results.\n\nFIGURE 7\n\nsMCT1 is a Na\\+\\-coupled transporter expressed solely on the apical membrane of the colonic epithelium that mediates SCFA influx from the lumen ([Ritzhaupt et al., 1998](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B36); [Kuwahara et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B31)). The western blot results showed that the expression level of sMCT1 did not change in IHLD rats compared to the control rats, as shown in [Figure 7A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7), consistent with the immunofluorescence results ([Figures 7G,H](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)).\n\n### Involvement of Na\\+ Absorption and Anion Secretion in the Colon of the IHLD-Induced Diarrhea Group\nIn order to investigate the basal and stimulated ion transport in the colonic epithelium of the IHLD group, a Ussing Chamber experiment was performed. In short circuit current recording, the basal current represents a summation of all ionic currents across the epithelium ([Xue et al., 2007](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B49); [Clarke, 2009](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B13)). The basal *I**SC* was lower in the IHLD-model group (IHLD: 48 ± 5.15 μA\/cm2 versus control: 108 ± 37.23 μA\/cm2, *n* = 10, [Figure 7A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)). In apical Na\\+\\-free KHS, the basal *I**SC* without apical Na\\+ absorption in the colonic mucosa of the control group was similar to that of the IHLD group (IHDL: −86.42 ± 7.8 μA\/cm2 versus control: −89.69 ± 11.41 μA\/cm2, *n* = 11). However, the Δbasal *I**SC* (subtract the basal *I**SC* in apical Na\\+\\-free KHS from the basal *I**SC* in normal KHS) in the colonic mucosa of the IHLD group was significantly decreased (IHLD 134.4 ± 2.65 μA\/cm2 versus control: 197.8 ± 25.82 μA\/cm2, *n* = 10, [Figure 7A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F7)), suggesting that Na\\+ absorption was lower in the IHLD group. After apical treatment with the ENaC inhibitor amiloride, a similar inhibition of basal *I**SC* was observed in the control and IHLD groups, excluding the ENaC involved in the ion transport of the IHLD group (IHLD: −6.54 ± 1.73 μA\/cm2 versus control: −6.98 ± 2.22 μA\/cm2, [Supplementary Figure S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#FS1)). As [Figure 8](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F8) shown, the results of western blotting and immunostaining showed that the level of total protein expression and phosphorylation of NHE3 protein-mediated Na\\+ absorption in the colon were downregulated by 37 and 67% respectively, in the model group compared with the control group ([Figures 8B–G](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F8)), which was responsible for the low Na\\+ absorption.\n\nFIGURE 8\n\nFurthermore, the cAMP elevator forskolin (1 μM, basolateral)-induced *I**SC* increase in the colon of the IHLD group was lower than that in the control group (IHLD: 128.3 ± 15.3 μA\/cm2 versus control: 201.4 ± 28.31 μA\/cm2, [Figure 9A](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F9)). The inhibition of basal *I**SC* induced by apical treatment with a known CFTR inhibitor DPC (diphenylamine-2, 2′-dicarboxylic acid), was significantly higher in the control group than in the IHLD group, suggesting that CFTR-mediated Cl– secretion under basal conditions was decreased in the IHLD group compared with the control group (IHLD: −1.12 ± 1.74 μA\/cm2 versus control: −8.10 ± 2.14 μA\/cm2, [Supplementary Figure S1](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#FS1)). The western blot and immunostaining results showed that the protein expression levels of NKCC1 and CFTR in the colonic mucosa were decrease by 50 and 24%,respectively, than those in the control group, contributing to the lower basal and stimulated ion secretion in the model group ([Figures 9B–G](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F9)).\n\nFIGURE 9\n\n### Discussion\nLactose intolerance (LI) appears to be mainly associated with unabsorbed lactose in the small intestine passing into the colon and being metabolized by colonic bacteria to organic acids, including lactic acid and short-chain fatty acids. The organic acids escaping absorption by the colon remain in the colonic lumen and lead to osmotic diarrhea. Previous studies have shown that lactose-induced diarrhea results, in large part, from the combination of net fluid secretion by the stomach and small intestine and interference with net fluid absorption in the colon ([Christopher and Bayless, 1971](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B12); [Hammer et al., 1989](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B21)).\n\nIn our study, we established a chronic diarrhea model using lactose with a gradual increase in concentration for 3 weeks to investigate the mechanism of high lactose-induced diarrhea on organic acid production and ion transport of the colonic epithelium and NHE3, CFTR and NKCC1 expression combined with epithelial locations, which are associated with Na\\+ absorption and Cl– secretion.\n\nThe concentrations of lactose, galactose and lactic acid in the cecum in the IHLD model group were higher than those in the control group, but the concentration of SCFAs was lower, suggesting that the major reason for hyperosmosis is due to high concentrations of lactose, galactose and lactic acid in the intestinal lumen, which could cause osmotic diarrhea. Furthermore, the concentration of lactic acid in the cecum content was much higher than that in the control group, which was responsible for the low pH in the feces. Adult rats, as mammals, have intestinal lactase activity that decreases quickly upon weaning, and research has shown that although residual lactase activity is present in adult rats, a high-lactose diet is poorly digested by adult rats ([Alexandre et al., 2013](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B2); [van de Heijning et al., 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B43)). The increase in galactose in the cecum contents after chronic feeding with high lactose might be due to microbiota fermentation. As expected, our results showed that significant differences were observed in the composition of cecum microbiota via high-throughput MiSeq sequencing after IHLD. A previous study ([Francavilla et al., 2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B18)) investigated the influence of lactose on the composition of the gut microbiota and the SCFAs of infants with cow’s milk allergy. Similar to our findings, lactose intake can induce an increase in Bifidobacteria and Lactobacilli and a decrease in the numbers of Bacteroides, Prevotella and Clostridia. In addition, we also found that the increased abundances of another two genera, Escherichia-shigella and Megamonas, were positively related to the concentrations of lactose, galactose and lactic acid and might be responsible for the IHLD-induced diarrhea. They also measured SCFA levels and found that the concentration of SCFA increased after addition of lactose, which was the opposite result of our study because of the differences between from infants and adults. In addition, we found the loss of important SCFA-producing microbes, such as lachnospiraceae NK4A136 group and ruminococcaceae UCG-005, after IHLD, which might lead to the lower concentration of luminal SCFAs, consistent with a recent study on a high-sugar diet ([Laffin et al., 2019](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B32)). Another recent study ([Kamphuis et al., 2019](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B28)) showed that oral gavage with lactose at a modest dose of 5 mg\/day for 3 weeks did not induce alterations in the fecal microbiota of mice, which was different from our study because of the low dose of lactose without significant malabsorption.\n\nIn our results, we found that the concentrations of SCFAs in the cecal contents of the model group was significantly decreased compared with that of the control group, which was different from a previous study that showed that an increase in SCFAs resulted in acute ingestion of lactose *in vivo* and *in vitro* ([He et al., 2006](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B22); [Windey et al., 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B48)). Few studies have focused on the effect of chronic lactose intervention on SCFAs, and a recent study ([Zhai et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B51)) found no significant difference in the SCFA concentration of feces after 3 weeks of lactulose intervention in mice, suggesting a different mechanism between acute and chronic ingestion. In the colon, SCFAs are absorbed by MCT1 and sMCT1 in the colon epithelium. Our results showed that an unaltered expression level and differential distribution of sMCT1 were observed between the control group and IHLD group. However, MCT1 expression was significantly decreased, showing that its low expression level might be caused by lower SCFAs in the lumen, which is also reported to be regulated by butyrate ([Borthakur et al., 2008](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B10), [2012](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B9)).\n\nCurrently, there is growing evidence indicating that SCFAs are a product of bacterial fermentation involved in the regulation of ion transport ([Yajima et al., 2011](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B50); [Tan et al., 2014](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B41); [Kuwahara et al., 2018](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B31)). Previous studies demonstrated that luminal addition of propionate stimulates chloride secretion, which function as a lubricant for the movement of luminal contents in the colon ([Yajima et al., 2011](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B50)). It has been reported that NHE3 mediates Na\\+ absorption in the colon, and our data showed that its expression and phosphorylation level were significantly decreased in the model group, confirming a decrease in Na\\+ absorption. The results of the Ussing Chamber demonstrated that when apical Na\\+ was removed, the delta basal *I**SC* in the IHLD group was significantly decreased, suggesting that Na\\+ absorption was involved in the basal current. It is generally accepted that the absorption of Na\\+ and Cl– in the colon is mutually interdependent, electrically neutral by largely apical Na\/H exchange and Cl\/HCO3 exchange processes, primarily involving the Na\/H exchanger NHE3 and the Cl\/HCO3 exchanger ([Walker et al., 2008](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B45)). The evidence from the present study showed that Na\\+ absorption and NHE3 protein expression and phosphorylation were decreased in IHLD rats compared with control rats, but the RNA level of NHE3 and the change in the expression of the Cl\/HCO3 exchanger involving Cl– absorption still need to be investigated. To the best of our knowledge, no previous report has found that NHE3 is involved in lactose-induced diarrhea and might be a novel target for the attenuation of lactose-induced diarrhea.\n\nIn this study, we used the chronic diarrhea model induced by giving high lactose for 3 weeks, which could employ a compensatory mechanism to adapt to the diarrhea situation. A previous study showed that rats adapted to a lactose diet and that the size of the cecum returned to normal, but its mechanisms are not clear ([Lawrence et al., 1956](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B33); [Szilagyi, 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B40)). Our results showed that basal current and FSK-induced Cl– secretion in the model group were lower than those in the control group, which can result in lower luminal anionic secretion and associated luminal transport of water. Furthermore, the NKCC1 and CFTR expression levels in the colon mucosa in the model group decreased compared with those in the control group, resulting in a decrease in basal and FSK-induced *I**SC*. We considered it to have resulted from the compensatory mechanism. In the duodenum, luminal SCFAs induced HCO3 \\- secretion ([Akiba et al., 2015](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#B1)). Our study showed that lower luminal SCFAs decrease Cl– secretion, but the mechanism should be investigated further.\n\nTaken together, IHLD feeding to rats caused a persistent state of diarrhea, and the cecum tripled in size. The concentrations of lactose, galactose and lactic acid were markedly increased in the cecal luminal contents, contributing to lactose intolerance-induced high osmosis diarrhea. Meanwhile, the lumen SCFA concentration of the cecal contents was significantly decreased. This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and an increase in the relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. In addition, the microbiota diversity in the colon was found to be lower in the cecum of IHLD rats compared with control rats. Concomitantly, the expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels in the colonic mucosa of the IHLD group contributed to the Na\\+ absorption and accumulation decrease in the lumen, and the stimulated Cl– secretion decrease would be a compensatory effect for water and electrolyte loss during the diarrhea process ([Figure 10](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#F10)). The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbita and Na\\+ absorption.\n\nFIGURE 10\n## Statements\n### Ethics statement\nThe animal study was reviewed and approved by the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2).\n\n### Author contributions\nHX, FW, and XT conceived the study. HX designed the experiment, wrote the manuscript, and performed the western blotting and immunostaining. MZ and JM made the animal models and performed the Ussing Chamber experiments. HX quantified SCFAs. HX and TC analyzed the data. FW and XT supervised the research. All authors contributed to the article and approved the submitted version.\n\n### Funding\nThis work was supported by the National Natural Science Foundation of China (Grant No. 81973838) and National Key Research and Development Project (Grant No. 2016YFC1302203).\n\n### Acknowledgments\nThe authors thank Prof. Wang Jiannong and Dr. Sun Caixia for their help for technical support on GC analyses for measuring SCFA levels.\n\n### Conflict of interest\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\n### Supplementary material\nThe Supplementary Material for this article can be found online at: [https:\/\/www.frontiersin.org\/articles\/10.3389\/fphys.2020.00877\/full\\#supplementary-material](https:\/\/www.frontiersin.org\/journals\/physiology\/articles\/10.3389\/fphys.2020.00877\/full#supplementary-material)\n\n**FIGURE S1**\n\nComparison of effect of DPC or amiloride on the basal *I**SC* current between control and IHLD group. Values are means ± SEM; *P* \\< 0.05.\n\n**TABLE S1**\n\nAntibodies for western and immunofluorescence.\n\n**TABLE S2**\n\nInformation of statistical test analysis of phylum and genus level between control and IHLD group.\n\n## References\n- 1\n  AkibaY.InoueT.KajiI.NarimatsuK.IwamotoK.et al (2015). Short-chain fatty acid sensing in rat duodenum.**J. Physiol.**593585–599. 10.1113\/jphysiol.2014.280792\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/25433076)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/jphysiol.2014.280792)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=Y..%2BAkiba&author=T..%2BInoue&author=I..%2BKaji&author=K..%2BNarimatsu&author=K..%2BIwamoto&publication_year=2015&title=Short-chain%2Bfatty%2Bacid%2Bsensing%2Bin%2Brat%2Bduodenum.&journal=J.+Physiol.&volume=593&pages=585-599)\n- 2\n  AlexandreV.EvenP. C.LarueA. C.BlouinJ. M.BlachierF.BenamouzigR.et al (2013). Lactose malabsorption and colonic fermentations alter host metabolism in rats.**Br. J. Nutr.**110625–631. 10.1017\/S0007114512005557\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23321004)\n  - [CrossRef](https:\/\/doi.org\/10.1017\/S0007114512005557)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=V..%2BAlexandre&author=P.%2BC..%2BEven&author=A.%2BC..%2BLarue&author=J.%2BM..%2BBlouin&author=F..%2BBlachier&author=R..%2BBenamouzig&publication_year=2013&title=Lactose%2Bmalabsorption%2Band%2Bcolonic%2Bfermentations%2Balter%2Bhost%2Bmetabolism%2Bin%2Brats.&journal=Br.+J.+Nutr.&volume=110&pages=625-631)\n- 3\n  Azcarate-PerilM. A.RitterA. J.SavaianoD.Monteagudo-MeraA.AndersonC.MagnessS. T. (2017). Impact of the short-chain galactooligosaccharides on the gut microbiome of lactose-intolerant individuals.**Proc. Natl. Acad. Sci. U.S.A.**114E367–E375. 10.1073\/pnas.1606722113\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/28049818)\n  - [CrossRef](https:\/\/doi.org\/10.1073\/pnas.1606722113)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=M.%2BA..%2BAzcarate-Peril&author=A.%2BJ..%2BRitter&author=D..%2BSavaiano&author=A..%2BMonteagudo-Mera&author=C..%2BAnderson&author=S.%2BT..%2BMagness&publication_year=2017&title=Impact%2Bof%2Bthe%2Bshort-chain%2Bgalactooligosaccharides%2Bon%2Bthe%2Bgut%2Bmicrobiome%2Bof%2Blactose-intolerant%2Bindividuals.&journal=Proc.+Natl.+Acad.+Sci.+U.S.A.&volume=114&pages=E367-E375)\n- 4\n  BaylessT. M.BrownE.PaigeD. M. (2017). Lactase Non-persistence and Lactose Intolerance.**Curr. Gastroenterol. Rep**19:23. 10.1007\/s11894-017-0558-9\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/28421381)\n  - [CrossRef](https:\/\/doi.org\/10.1007\/s11894-017-0558-9)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T.%2BM..%2BBayless&author=E..%2BBrown&author=D.%2BM..%2BPaige&publication_year=2017&title=Lactase%2BNon-persistence%2Band%2BLactose%2BIntolerance.&journal=Curr.+Gastroenterol.+Rep&volume=19)\n- 5\n  BinderH. J. (2010). Role of Colonic Short-chain fatty acid transport in diarrhea.**Annu. Rev. Physiol*.*72297–313. 10.1146\/annurev-physiol-021909-135817\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/20148677)\n  - [CrossRef](https:\/\/doi.org\/10.1146\/annurev-physiol-021909-135817)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BJ..%2BBinder&publication_year=2010&title=Role%2Bof%2BColonic%2BShort-chain%2Bfatty%2Bacid%2Btransport%2Bin%2Bdiarrhea.&journal=Annu.+Rev.+Physiol.&volume=72&pages=297-313)\n- 6\n  BinderH. J.FosterE. S.BudingerM. E.HayslettJ. P. (1987). Mechanism of electroneutral sodium chloride absorption in distal colon of the rat.**Gastroenterology**93449–455. 10.1016\/0016-5085(87)90905-x\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/0016-5085\\(87\\)90905-x)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BJ..%2BBinder&author=E.%2BS..%2BFoster&author=M.%2BE..%2BBudinger&author=J.%2BP..%2BHayslett&publication_year=1987&title=Mechanism%2Bof%2Belectroneutral%2Bsodium%2Bchloride%2Babsorption%2Bin%2Bdistal%2Bcolon%2Bof%2Bthe%2Brat.&journal=Gastroenterology&volume=93&pages=449-455)\n- 7\n  BinderH. J.SandleG. I.RajendranV. M. (1991). “Colonic fluid and electrolyte transport in health and disease,” in **The Large Intestine: Physiology, Pathophysiology, and Disease**, edsPhillipsS. F.PembertonJ. H.ShorterR. G. (New York, NY: Raven Press), 141–168.\n  \n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BJ..%2BBinder&author=G.%2BI..%2BSandle&author=V.%2BM..%2BRajendran&publication_year=1991&title=Colonic%2Bfluid%2Band%2Belectrolyte%2Btransport%2Bin%2Bhealth%2Band%2Bdisease&journal=The+Large+Intestine%3A+Physiology%2C+Pathophysiology%2C+and+Disease&pages=141-168)\n- 8\n  BoakyeP. A.BrierleyS. M.BalembaO. B. (2012). Garcinia buchananii bark extract is an effective anti-diarrheal remedy for lactose-induced diarrhea.**J. Ethnopharmacol.**142539–547. 10.1016\/j.jep.2012.05.034\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22643232)\n  - [CrossRef](https:\/\/doi.org\/10.1016\/j.jep.2012.05.034)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=P.%2BA..%2BBoakye&author=S.%2BM..%2BBrierley&author=O.%2BB..%2BBalemba&publication_year=2012&title=Garcinia%2Bbuchananii%2Bbark%2Bextract%2Bis%2Ban%2Beffective%2Banti-diarrheal%2Bremedy%2Bfor%2Blactose-induced%2Bdiarrhea.&journal=J.+Ethnopharmacol.&volume=142&pages=539-547)\n- 9\n  BorthakurA.PriyamvadaS.KumarA.NatarajanA. A.GillR. K.AlrefaiW. A.et al (2012). A novel nutrient sensing mechanism underlies substrate-induced regulation of monocarboxylate transporter 1.**Am. J. Physiol. Gastrointest. Liver. Physiol.**303G1126–G1133. 10.1152\/ajpgi.00308.2012\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22982338)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/ajpgi.00308.2012)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BBorthakur&author=S..%2BPriyamvada&author=A..%2BKumar&author=A.%2BA..%2BNatarajan&author=R.%2BK..%2BGill&author=W.%2BA..%2BAlrefai&publication_year=2012&title=A%2Bnovel%2Bnutrient%2Bsensing%2Bmechanism%2Bunderlies%2Bsubstrate-induced%2Bregulation%2Bof%2Bmonocarboxylate%2Btransporter%2B1.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=303&pages=G1126-G1133)\n- 10\n  BorthakurA.SaksenaS.GillR. K.AlrefaiW. A.RamaswamyK.DudejaP. K. (2008). Regulation of monocarboxylate transporter 1 (MCT1) promoter by butyrate in human intestinal epithelial cells: Involvement of NF-κB pathway.**J. Cell. Biochem.**1031452–1463. 10.1002\/jcb.21532\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/17786924)\n  - [CrossRef](https:\/\/doi.org\/10.1002\/jcb.21532)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BBorthakur&author=S..%2BSaksena&author=R.%2BK..%2BGill&author=W.%2BA..%2BAlrefai&author=K..%2BRamaswamy&author=P.%2BK..%2BDudeja&publication_year=2008&title=Regulation%2Bof%2Bmonocarboxylate%2Btransporter%2B1%2B%28MCT1%29%2Bpromoter%2Bby%2Bbutyrate%2Bin%2Bhuman%2Bintestinal%2Bepithelial%2Bcells%3A%2BInvolvement%2Bof%2BNF-%CE%BAB%2Bpathway.&journal=J.+Cell.+Biochem.&volume=103&pages=1452-1463)\n- 11\n  BryceJ.BoschiP. C.ShibuyaK.BlackR. E. (2005). WHO estimates of the causes of death in children.**Lancet**3651147–1152. 10.1016\/S0140-6736(05)71877-8\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/S0140-6736\\(05\\)71877-8)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J..%2BBryce&author=P.%2BC..%2BBoschi&author=K..%2BShibuya&author=R.%2BE..%2BBlack&publication_year=2005&title=WHO%2Bestimates%2Bof%2Bthe%2Bcauses%2Bof%2Bdeath%2Bin%2Bchildren.&journal=Lancet&volume=365&pages=1147-1152)\n- 12\n  ChristopherN. L.BaylessT. M. (1971). Role of the small bowel and colon in lactose-induced diarrhea.**Gastroenterology**60845–852. 10.1016\/s0016-5085(71)80083-5\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/s0016-5085\\(71\\)80083-5)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=N.%2BL..%2BChristopher&author=T.%2BM..%2BBayless&publication_year=1971&title=Role%2Bof%2Bthe%2Bsmall%2Bbowel%2Band%2Bcolon%2Bin%2Blactose-induced%2Bdiarrhea.&journal=Gastroenterology&volume=60&pages=845-852)\n- 13\n  ClarkeL. L. (2009). A guide to Ussing chamber studies of mouse intestine.**Am. J. Physiol. Gastrointest. Liver. Physiol.**296G1151–G1166. 10.1152\/ajpgi.90649.2008\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/19342508)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/ajpgi.90649.2008)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=L.%2BL..%2BClarke&publication_year=2009&title=A%2Bguide%2Bto%2BUssing%2Bchamber%2Bstudies%2Bof%2Bmouse%2Bintestine.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=296&pages=G1151-G1166)\n- 14\n  ColeJ. R.WangQ. E.CardenasJ.FishB.ChaiR. J.FarrisA. S.et al (2009). The ribosomal database project: improved alignments and new tools for rRNA analysis.**Nucleic Acids Res.**37D141–D145. 10.1093\/nar\/gkn879\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/19004872)\n  - [CrossRef](https:\/\/doi.org\/10.1093\/nar\/gkn879)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J.%2BR..%2BCole&author=Q.%2BE..%2BWang&author=J..%2BCardenas&author=B..%2BFish&author=R.%2BJ..%2BChai&author=A.%2BS..%2BFarris&publication_year=2009&title=The%2Bribosomal%2Bdatabase%2Bproject%3A%2Bimproved%2Balignments%2Band%2Bnew%2Btools%2Bfor%2BrRNA%2Banalysis.&journal=Nucleic+Acids+Res.&volume=37&pages=D141-D145)\n- 15\n  DavidL. A.MauriceC. F.ButtonJ. E.WolfeB. E.et al (2014). Diet rapidly and reproducibly alters the human gut microbiome.**Nature**505559–563. 10.1038\/nature12820\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/24336217)\n  - [CrossRef](https:\/\/doi.org\/10.1038\/nature12820)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=L.%2BA..%2BDavid&author=C.%2BF..%2BMaurice&author=J.%2BE..%2BButton&author=B.%2BE..%2BWolfe&publication_year=2014&title=Diet%2Brapidly%2Band%2Breproducibly%2Balters%2Bthe%2Bhuman%2Bgut%2Bmicrobiome.&journal=Nature&volume=505&pages=559-563)\n- 16\n  EdgarR. C. (2013). UPARSE: Highly accurate OTU sequences from microbial amplicon reads.**Nat Methods**10996–998. 10.1038\/nmeth.2604\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23955772)\n  - [CrossRef](https:\/\/doi.org\/10.1038\/nmeth.2604)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=R.%2BC..%2BEdgar&publication_year=2013&title=UPARSE%3A%2BHighly%2Baccurate%2BOTU%2Bsequences%2Bfrom%2Bmicrobial%2Bamplicon%2Breads.&journal=Nat+Methods&volume=10&pages=996-998)\n- 17\n  FassioF.FacioniM. S.GuagniniF. (2018). Lactose maldigestion, malabsorption, and intolerance: a comprehensive review with focus on current management and future perspectives.**Nutrients**10:1599. 10.3390\/nu10111599\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/30388735)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/nu10111599)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=F..%2BFassio&author=M.%2BS..%2BFacioni&author=F..%2BGuagnini&publication_year=2018&title=Lactose%2Bmaldigestion%2C%2Bmalabsorption%2C%2Band%2Bintolerance%3A%2Ba%2Bcomprehensive%2Breview%2Bwith%2Bfocus%2Bon%2Bcurrent%2Bmanagement%2Band%2Bfuture%2Bperspectives.&journal=Nutrients&volume=10)\n- 18\n  FrancavillaR.CalassoM.CalaceL.SiragusaS.NdagijimanaM.VernocchiP.et al (2012). Effect of lactose on gut microbiota and metabolome of infants with cow’s milk allergy.**Pediatr. Allergy Immunol.**3420–427. 10.1111\/j.1399-3038.2012.01286.x\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22435727)\n  - [CrossRef](https:\/\/doi.org\/10.1111\/j.1399-3038.2012.01286.x)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=R..%2BFrancavilla&author=M..%2BCalasso&author=L..%2BCalace&author=S..%2BSiragusa&author=M..%2BNdagijimana&author=P..%2BVernocchi&publication_year=2012&title=Effect%2Bof%2Blactose%2Bon%2Bgut%2Bmicrobiota%2Band%2Bmetabolome%2Bof%2Binfants%2Bwith%2Bcow%E2%80%99s%2Bmilk%2Ballergy.&journal=Pediatr.+Allergy+Immunol.&volume=3&pages=420-427)\n- 19\n  GanapathyV.GopalE.MiyauchiS.PrasadP. D. (2005). Biological functions of SLC5A8,candidate tumour suppressor.**Biochem. Soc. Trans.**33(Pt 1)237–240. 10.1042\/BST0330237\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/15667316)\n  - [CrossRef](https:\/\/doi.org\/10.1042\/BST0330237)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=V..%2BGanapathy&author=E..%2BGopal&author=S..%2BMiyauchi&author=P.%2BD..%2BPrasad&publication_year=2005&title=Biological%2Bfunctions%2Bof%2BSLC5A8%2Ccandidate%2Btumour%2Bsuppressor.&journal=Biochem.+Soc.+Trans.&volume=33%28Pt+1%29&pages=237-240)\n- 20\n  HammerH. F.HammerJ. (2012). Diarrhea caused by carbohydrate malabsorption.**Gastroenterol. Clin. N. Am.**41611–627. 10.1016\/j.gtc.2012.06.003\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22917167)\n  - [CrossRef](https:\/\/doi.org\/10.1016\/j.gtc.2012.06.003)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BF..%2BHammer&author=J..%2BHammer&publication_year=2012&title=Diarrhea%2Bcaused%2Bby%2Bcarbohydrate%2Bmalabsorption.&journal=Gastroenterol.+Clin.+N.+Am.&volume=41&pages=611-627)\n- 21\n  HammerH. F.Santa AnaC. A.SchillerL. R.FordtranJ. S. (1989). Studies of osmotic diarrhea induced in normal subjects by ingestion of polyethylene glycol and lactulose.**J. Clin. Invest.**841056–1062. 10.1172\/JCI114267\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/2794043)\n  - [CrossRef](https:\/\/doi.org\/10.1172\/JCI114267)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H.%2BF..%2BHammer&author=C.%2BA..%2BSanta%2BAna&author=L.%2BR..%2BSchiller&author=J.%2BS..%2BFordtran&publication_year=1989&title=Studies%2Bof%2Bosmotic%2Bdiarrhea%2Binduced%2Bin%2Bnormal%2Bsubjects%2Bby%2Bingestion%2Bof%2Bpolyethylene%2Bglycol%2Band%2Blactulose.&journal=J.+Clin.+Invest.&volume=84&pages=1056-1062)\n- 22\n  HeT.PriebeM. G.HarmsenH. J.StellaardF.SunX.WellingG. W.et al (2006). Colonic fermentation may play a role in lactose intolerance in humans.**J. Nutr.**13658–63. 10.1093\/jn\/136.1.58\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/16365059)\n  - [CrossRef](https:\/\/doi.org\/10.1093\/jn\/136.1.58)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T..%2BHe&author=M.%2BG..%2BPriebe&author=H.%2BJ..%2BHarmsen&author=F..%2BStellaard&author=X..%2BSun&author=G.%2BW..%2BWelling&publication_year=2006&title=Colonic%2Bfermentation%2Bmay%2Bplay%2Ba%2Brole%2Bin%2Blactose%2Bintolerance%2Bin%2Bhumans.&journal=J.+Nutr.&volume=136&pages=58-63)\n- 23\n  HoqueK. M.ChakrabortyS.SheikhI. A.WoodwardO. M. (2012). New advances in the pathophysiology of intestinal ion transport and barrier function in diarrhea and the impact on therapy.**Expert Rev. Anti Infect. Ther.**10687–699. 10.1586\/eri.12.47\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/22734958)\n  - [CrossRef](https:\/\/doi.org\/10.1586\/eri.12.47)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=K.%2BM..%2BHoque&author=S..%2BChakraborty&author=I.%2BA..%2BSheikh&author=O.%2BM..%2BWoodward&publication_year=2012&title=New%2Badvances%2Bin%2Bthe%2Bpathophysiology%2Bof%2Bintestinal%2Bion%2Btransport%2Band%2Bbarrier%2Bfunction%2Bin%2Bdiarrhea%2Band%2Bthe%2Bimpact%2Bon%2Btherapy.&journal=Expert+Rev.+Anti+Infect.+Ther.&volume=10&pages=687-699)\n- 24\n  IwanagaT.TakebeK.KatoI.KarakiS.KuwaharaA. (2006). Cellular expression of monocarboxylate transporters (MCT) in the digestive tract of the mouse, rat, and humans, with special reference to slc5a8.**Biomed. Res.**27243–254. 10.2220\/biomedres.27.243\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/17099289)\n  - [CrossRef](https:\/\/doi.org\/10.2220\/biomedres.27.243)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T..%2BIwanaga&author=K..%2BTakebe&author=I..%2BKato&author=S..%2BKaraki&author=A..%2BKuwahara&publication_year=2006&title=Cellular%2Bexpression%2Bof%2Bmonocarboxylate%2Btransporters%2B%28MCT%29%2Bin%2Bthe%2Bdigestive%2Btract%2Bof%2Bthe%2Bmouse%2C%2Brat%2C%2Band%2Bhumans%2C%2Bwith%2Bspecial%2Breference%2Bto%2Bslc5a8.&journal=Biomed.+Res.&volume=27&pages=243-254)\n- 25\n  JamiE.IsraelA.KotserA.MizrahiI. (2013). Exploring the bovine rumen bacterial community from birth to adulthood.**ISME J*.*71069–1079. 10.1038\/ismej.2013.2\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23426008)\n  - [CrossRef](https:\/\/doi.org\/10.1038\/ismej.2013.2)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=E..%2BJami&author=A..%2BIsrael&author=A..%2BKotser&author=I..%2BMizrahi&publication_year=2013&title=Exploring%2Bthe%2Bbovine%2Brumen%2Bbacterial%2Bcommunity%2Bfrom%2Bbirth%2Bto%2Badulthood.&journal=ISME+J.&volume=7&pages=1069-1079)\n- 26\n  JiangX. T.PengX.DengG. H.ShengH. F.WangY.ZhouH. W. (2013). Illumina sequencing of 16S rRNA Tag revealed spatial variations of bacterial communities in a mangrove wetland.**Microb. Ecol.**6696–104. 10.1007\/s00248-013-0238-8\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23649297)\n  - [CrossRef](https:\/\/doi.org\/10.1007\/s00248-013-0238-8)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=X.%2BT..%2BJiang&author=X..%2BPeng&author=G.%2BH..%2BDeng&author=H.%2BF..%2BSheng&author=Y..%2BWang&author=H.%2BW..%2BZhou&publication_year=2013&title=Illumina%2Bsequencing%2Bof%2B16S%2BrRNA%2BTag%2Brevealed%2Bspatial%2Bvariations%2Bof%2Bbacterial%2Bcommunities%2Bin%2Ba%2Bmangrove%2Bwetland.&journal=Microb.+Ecol.&volume=66&pages=96-104)\n- 27\n  KajiI.AkibaY.KonnoK.WatanabeM.KimuraS.IwanagaT. (2016). Neural FFA3 activation inversely regulates anion secretion evoked by nicotinic ACh receptor activation in rat.**J. Physiol.**5943339–3352. 10.1113\/JP271441\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/26854275)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/JP271441)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=I..%2BKaji&author=Y..%2BAkiba&author=K..%2BKonno&author=M..%2BWatanabe&author=S..%2BKimura&author=T..%2BIwanaga&publication_year=2016&title=Neural%2BFFA3%2Bactivation%2Binversely%2Bregulates%2Banion%2Bsecretion%2Bevoked%2Bby%2Bnicotinic%2BACh%2Breceptor%2Bactivation%2Bin%2Brat.&journal=J.+Physiol.&volume=594&pages=3339-3352)\n- 28\n  KamphuisJ. B. J.GuiardB.LevequeM.OlierM.JouaninI.YvonS.et al (2019). Lactose and fructo-ligosaccharides increase visceral sensitivity in mice via glycation processes, increasing mast cell density in colonic mucosa.**Gastroenterology**158652–663.e6. 10.1053\/j.gastro.2019.10.037652663e6\n  \n  - [CrossRef](https:\/\/doi.org\/10.1053\/j.gastro.2019.10.037652663e6)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J.%2BB.%2BJ..%2BKamphuis&author=B..%2BGuiard&author=M..%2BLeveque&author=M..%2BOlier&author=I..%2BJouanin&author=S..%2BYvon&publication_year=2019&title=Lactose%2Band%2Bfructo-ligosaccharides%2Bincrease%2Bvisceral%2Bsensitivity%2Bin%2Bmice%2Bvia%2Bglycation%2Bprocesses%2C%2Bincreasing%2Bmast%2Bcell%2Bdensity%2Bin%2Bcolonic%2Bmucosa.&journal=Gastroenterology&volume=158&pages=652-663.e6)\n- 29\n  KiratD.KondoK.ShimadaR.KatoS. (2009). Dietary pectin up-regulates monocaboxylate transporter1 in the rat gastrointestinal tract.**Exp. Physiol.**94422–433. 10.1113\/expphysiol.2009.046797\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/19168540)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/expphysiol.2009.046797)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=D..%2BKirat&author=K..%2BKondo&author=R..%2BShimada&author=S..%2BKato&publication_year=2009&title=Dietary%2Bpectin%2Bup-regulates%2Bmonocaboxylate%2Btransporter1%2Bin%2Bthe%2Brat%2Bgastrointestinal%2Btract.&journal=Exp.+Physiol.&volume=94&pages=422-433)\n- 30\n  KunzelmannK.MallM. (2002). Electrolyte transport in the mammalian colon: mechanisms and implications for disease.**Physiol Rev.**82245–289. 10.1152\/physrev.00026.2001\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/11773614)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/physrev.00026.2001)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=K..%2BKunzelmann&author=M..%2BMall&publication_year=2002&title=Electrolyte%2Btransport%2Bin%2Bthe%2Bmammalian%2Bcolon%3A%2Bmechanisms%2Band%2Bimplications%2Bfor%2Bdisease.&journal=Physiol+Rev.&volume=82&pages=245-289)\n- 31\n  KuwaharaA.KuwaharaY.InuiT.MarunakaY. (2018). Regulation of ion transport in the intestine by free fatty acid receptor 2 and 3: possible involvement of the diffuse chemosensory system.**Int. J. Mol. Sci.**19:735. 10.3390\/ijms19030735\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/29510573)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/ijms19030735)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BKuwahara&author=Y..%2BKuwahara&author=T..%2BInui&author=Y..%2BMarunaka&publication_year=2018&title=Regulation%2Bof%2Bion%2Btransport%2Bin%2Bthe%2Bintestine%2Bby%2Bfree%2Bfatty%2Bacid%2Breceptor%2B2%2Band%2B3%3A%2Bpossible%2Binvolvement%2Bof%2Bthe%2Bdiffuse%2Bchemosensory%2Bsystem.&journal=Int.+J.+Mol.+Sci.&volume=19)\n- 32\n  LaffinM.FedorakR.ZalaskyA.ParkH.GillA.AgrawalA. (2019). A high-sugar diet rapidly enhances susceptibility to colitis via depletion of luminal short-chainfatty acids in mice.**Sci. Rep.**9:12294. 10.1038\/s41598-019-48749-2\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/31444382)\n  - [CrossRef](https:\/\/doi.org\/10.1038\/s41598-019-48749-2)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=M..%2BLaffin&author=R..%2BFedorak&author=A..%2BZalasky&author=H..%2BPark&author=A..%2BGill&author=A..%2BAgrawal&publication_year=2019&title=A%2Bhigh-sugar%2Bdiet%2Brapidly%2Benhances%2Bsusceptibility%2Bto%2Bcolitis%2Bvia%2Bdepletion%2Bof%2Bluminal%2Bshort-chainfatty%2Bacids%2Bin%2Bmice.&journal=Sci.+Rep.&volume=9)\n- 33\n  LawrenceJ. V.FischerJ. E.SuttonT. S.WeiserH. H. (1956). Adaptation of the rat to a higher lactose diet, effect of the size of the cecum.**Ohio J. Sci.**5687–92.\n  \n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J.%2BV..%2BLawrence&author=J.%2BE..%2BFischer&author=T.%2BS..%2BSutton&author=H.%2BH..%2BWeiser&publication_year=1956&title=Adaptation%2Bof%2Bthe%2Brat%2Bto%2Ba%2Bhigher%2Blactose%2Bdiet%2C%2Beffect%2Bof%2Bthe%2Bsize%2Bof%2Bthe%2Bcecum.&journal=Ohio+J.+Sci.&volume=56&pages=87-92)\n- 34\n  LiuzziJ. P.HeviaP. (1998). In well-fed young rats, lactose-induced chronic diarrhea reduces the apparent absorption of vitamins A and E and affects preferentially vitamin E status.**J. Nutr.**1282467–2472. 10.1093\/jn\/128.12.2467\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/9868195)\n  - [CrossRef](https:\/\/doi.org\/10.1093\/jn\/128.12.2467)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J.%2BP..%2BLiuzzi&author=P..%2BHevia&publication_year=1998&title=In%2Bwell-fed%2Byoung%2Brats%2C%2Blactose-induced%2Bchronic%2Bdiarrhea%2Breduces%2Bthe%2Bapparent%2Babsorption%2Bof%2Bvitamins%2BA%2Band%2BE%2Band%2Baffects%2Bpreferentially%2Bvitamin%2BE%2Bstatus.&journal=J.+Nutr.&volume=128&pages=2467-2472)\n- 35\n  MuschM. W.BooksteinC.XieY.SellinJ. H.ChangE. B. (2001). SCFA increase intestinal Na absorption by induction of NHE3 in rat colon and human intestinal C2\/bbe cells.**Am. J. Physiol. Gastrointest. Liver Physiol.**280G687–G693. 10.1152\/ajpgi.2001.280.4.G687\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/11254495)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/ajpgi.2001.280.4.G687)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=M.%2BW..%2BMusch&author=C..%2BBookstein&author=Y..%2BXie&author=J.%2BH..%2BSellin&author=E.%2BB..%2BChang&publication_year=2001&title=SCFA%2Bincrease%2Bintestinal%2BNa%2Babsorption%2Bby%2Binduction%2Bof%2BNHE3%2Bin%2Brat%2Bcolon%2Band%2Bhuman%2Bintestinal%2BC2%2Fbbe%2Bcells.&journal=Am.+J.+Physiol.+Gastrointest.+Liver+Physiol.&volume=280&pages=G687-G693)\n- 36\n  RitzhauptA.WoodI. S.EllisA.HosieK. B.Shirazi-BeecheyS. P. (1998). Identification and characterization of a monocarboxylate transporter (MCT1) in pig and human colon: its potential to transport L-lactate as well as butyrate.**J. Physiol.**513(Pt 3)719–732. 10.1111\/j.1469-7793.1998.719ba.x\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/9824713)\n  - [CrossRef](https:\/\/doi.org\/10.1111\/j.1469-7793.1998.719ba.x)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BRitzhaupt&author=I.%2BS..%2BWood&author=A..%2BEllis&author=K.%2BB..%2BHosie&author=S.%2BP..%2BShirazi-Beechey&publication_year=1998&title=Identification%2Band%2Bcharacterization%2Bof%2Ba%2Bmonocarboxylate%2Btransporter%2B%28MCT1%29%2Bin%2Bpig%2Band%2Bhuman%2Bcolon%3A%2Bits%2Bpotential%2Bto%2Btransport%2BL-lactate%2Bas%2Bwell%2Bas%2Bbutyrate.&journal=J.+Physiol.&volume=513%28Pt+3%29&pages=719-732)\n- 37\n  SivaprakasamS.BhutiaY. D.YangS.GanapathyV. (2017). Short-chain fatty acid transporters: role in colonic homeostasis.**Compr. Physiol.**8299–314. 10.1002\/cphy.c170014\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/29357130)\n  - [CrossRef](https:\/\/doi.org\/10.1002\/cphy.c170014)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=S..%2BSivaprakasam&author=Y.%2BD..%2BBhutia&author=S..%2BYang&author=V..%2BGanapathy&publication_year=2017&title=Short-chain%2Bfatty%2Bacid%2Btransporters%3A%2Brole%2Bin%2Bcolonic%2Bhomeostasis.&journal=Compr.+Physiol.&volume=8&pages=299-314)\n- 38\n  SubramanyaS. B.RajendranV. M.SrinivasanP.NandaK. N. S.BinderH. J. (2007). Differential regulation of cholera toxin-inhibited Na-H exchange isoforms by butyrate in rat ileum.**Am. J. Physiol. Gastrointest. Liver. Physiol.**293G857–G863. 10.1152\/ajpgi.00462.2006\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/17690171)\n  - [CrossRef](https:\/\/doi.org\/10.1152\/ajpgi.00462.2006)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=S.%2BB..%2BSubramanya&author=V.%2BM..%2BRajendran&author=P..%2BSrinivasan&author=K.%2BN.%2BS..%2BNanda&author=H.%2BJ..%2BBinder&publication_year=2007&title=Differential%2Bregulation%2Bof%2Bcholera%2Btoxin-inhibited%2BNa-H%2Bexchange%2Bisoforms%2Bby%2Bbutyrate%2Bin%2Brat%2Bileum.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=293&pages=G857-G863)\n- 39\n  SwagertyD. L.Jr.WallingA. D.KleinR. M. (2002). Lactose intolerance.**Am. Fam. Physician.**651845–1850.\n  \n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=D.%2BL..%2BSwagerty&author=A.%2BD..%2BWalling&author=R.%2BM..%2BKlein&publication_year=2002&title=Lactose%2Bintolerance.&journal=Am.+Fam.+Physician.&volume=65&pages=1845-1850)\n- 40\n  SzilagyiA. (2015). Adaptation to lactose in lactase non persistent people: Effects on intolerance and the relationship between Dairy Food consumption and evalution of diseases.**Nutrients**76751–6779. 10.3390\/nu7085309\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/26287234)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/nu7085309)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=A..%2BSzilagyi&publication_year=2015&title=Adaptation%2Bto%2Blactose%2Bin%2Blactase%2Bnon%2Bpersistent%2Bpeople%3A%2BEffects%2Bon%2Bintolerance%2Band%2Bthe%2Brelationship%2Bbetween%2BDairy%2BFood%2Bconsumption%2Band%2Bevalution%2Bof%2Bdiseases.&journal=Nutrients&volume=7&pages=6751-6779)\n- 41\n  TanJ.McKenzieC.PotamitisM.ThorburnA. N.MackayC. R.MaciaL. (2014). The role of short-chain fatty acids in health and disease.**Adv. Immunol.**12191–119. 10.1016\/B978-0-12-800100-4.00003-9\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/24388214)\n  - [CrossRef](https:\/\/doi.org\/10.1016\/B978-0-12-800100-4.00003-9)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=J..%2BTan&author=C..%2BMcKenzie&author=M..%2BPotamitis&author=A.%2BN..%2BThorburn&author=C.%2BR..%2BMackay&author=L..%2BMacia&publication_year=2014&title=The%2Brole%2Bof%2Bshort-chain%2Bfatty%2Bacids%2Bin%2Bhealth%2Band%2Bdisease.&journal=Adv.+Immunol.&volume=121&pages=91-119)\n- 42\n  ThaparN.SandersonI. R. (2004). Diarrhoea in children: an interface between developing and developed countries.**Lancet**363641–653. 10.1016\/S0140-6736(04)15599-2\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/S0140-6736\\(04\\)15599-2)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=N..%2BThapar&author=I.%2BR..%2BSanderson&publication_year=2004&title=Diarrhoea%2Bin%2Bchildren%3A%2Ban%2Binterface%2Bbetween%2Bdeveloping%2Band%2Bdeveloped%2Bcountries.&journal=Lancet&volume=363&pages=641-653)\n- 43\n  van de HeijningB. J.SchipperL.VoogdE.OostingA.van der BeekE. M. (2015). Acute and chronic effects of dietary lactose in adult rats are not explained by residual intestinal lactase activity.**Nutrients**75542–5555. 10.3390\/nu7075237\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/26184291)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/nu7075237)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=B.%2BJ..%2Bvan%2Bde%2BHeijning&author=L..%2BSchipper&author=E..%2BVoogd&author=A..%2BOosting&author=E.%2BM..%2Bvan%2Bder%2BBeek&publication_year=2015&title=Acute%2Band%2Bchronic%2Beffects%2Bof%2Bdietary%2Blactose%2Bin%2Badult%2Brats%2Bare%2Bnot%2Bexplained%2Bby%2Bresidual%2Bintestinal%2Blactase%2Bactivity.&journal=Nutrients&volume=7&pages=5542-5555)\n- 44\n  VidyasagarS.RamakrishnaB. S. (2002). Effects of butyrate on active sodium and chloride transport in rat and rabbit distal colon.**J. Physiol.**539(Pt 1)163–173. 10.1113\/jphysiol.2001.013056\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/11850510)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/jphysiol.2001.013056)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=S..%2BVidyasagar&author=B.%2BS..%2BRamakrishna&publication_year=2002&title=Effects%2Bof%2Bbutyrate%2Bon%2Bactive%2Bsodium%2Band%2Bchloride%2Btransport%2Bin%2Brat%2Band%2Brabbit%2Bdistal%2Bcolon.&journal=J.+Physiol.&volume=539%28Pt+1%29&pages=163-173)\n- 45\n  WalkerN. M.SimpsonJ. E.YenP. F.GillR. K.RigsbyE. V.BrazillJ. M. (2008). Down-regulated in adenoma Cl\/HCO3 exchanger couples with Na\/H exchanger 3 for NaCl absorptionin murine small intestine.**Gastroenterology**1351645–1653.\n  \n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=N.%2BM..%2BWalker&author=J.%2BE..%2BSimpson&author=P.%2BF..%2BYen&author=R.%2BK..%2BGill&author=E.%2BV..%2BRigsby&author=J.%2BM..%2BBrazill&publication_year=2008&title=Down-regulated%2Bin%2Badenoma%2BCl%2FHCO3%2Bexchanger%2Bcouples%2Bwith%2BNa%2FH%2Bexchanger%2B3%2Bfor%2BNaCl%2Babsorptionin%2Bmurine%2Bsmall%2Bintestine.&journal=Gastroenterology&volume=135&pages=1645-1653)\n- 46\n  WangY.ShengH. F.HeY.WuJ. Y.JiangY. X.TamN. F. (2012). Comparison of the levels of bacterial diversity in fresh water, intertidal wetland, and marine sediments by using millions of Illumina Tags.**Appl. Environ. Microbiol.**78:8264. 10.1128\/AEM.01821-12\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/23001654)\n  - [CrossRef](https:\/\/doi.org\/10.1128\/AEM.01821-12)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=Y..%2BWang&author=H.%2BF..%2BSheng&author=Y..%2BHe&author=J.%2BY..%2BWu&author=Y.%2BX..%2BJiang&author=N.%2BF..%2BTam&publication_year=2012&title=Comparison%2Bof%2Bthe%2Blevels%2Bof%2Bbacterial%2Bdiversity%2Bin%2Bfresh%2Bwater%2C%2Bintertidal%2Bwetland%2C%2Band%2Bmarine%2Bsediments%2Bby%2Busing%2Bmillions%2Bof%2BIllumina%2BTags.&journal=Appl.+Environ.+Microbiol.&volume=78)\n- 47\n  WardlawT.SalamaP.BrocklehurstC.ChopraM.MasonE. (2010). Diarrhoea: why children are still dying and what can be done.**Lancet**375870–872. 10.1016\/S0140-6736(09)61798-0\n  \n  - [CrossRef](https:\/\/doi.org\/10.1016\/S0140-6736\\(09\\)61798-0)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T..%2BWardlaw&author=P..%2BSalama&author=C..%2BBrocklehurst&author=M..%2BChopra&author=E..%2BMason&publication_year=2010&title=Diarrhoea%3A%2Bwhy%2Bchildren%2Bare%2Bstill%2Bdying%2Band%2Bwhat%2Bcan%2Bbe%2Bdone.&journal=Lancet&volume=375&pages=870-872)\n- 48\n  WindeyK.HoubenE.DerooverL.VerbekeK. (2015). Contribution of colonic fermentation and fecal water toxicity to the pathophysiology of lactose-intolerance.**Nutrients**77505–7522. 10.3390\/nu7095349\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/26371036)\n  - [CrossRef](https:\/\/doi.org\/10.3390\/nu7095349)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=K..%2BWindey&author=E..%2BHouben&author=L..%2BDeroover&author=K..%2BVerbeke&publication_year=2015&title=Contribution%2Bof%2Bcolonic%2Bfermentation%2Band%2Bfecal%2Bwater%2Btoxicity%2Bto%2Bthe%2Bpathophysiology%2Bof%2Blactose-intolerance.&journal=Nutrients&volume=7&pages=7505-7522)\n- 49\n  XueH.TianY. M.YanM.YangN.XingY.et al (2007). Appearance of segmental discrepancy of anion transport in rat distal colon.**Biol. Pharm. Bull.**301407–1411. 10.1248\/bpb.30.1407\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/17666794)\n  - [CrossRef](https:\/\/doi.org\/10.1248\/bpb.30.1407)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=H..%2BXue&author=Y.%2BM..%2BTian&author=M..%2BYan&author=N..%2BYang&author=Y..%2BXing&publication_year=2007&title=Appearance%2Bof%2Bsegmental%2Bdiscrepancy%2Bof%2Banion%2Btransport%2Bin%2Brat%2Bdistal%2Bcolon.&journal=Biol.+Pharm.+Bull.&volume=30&pages=1407-1411)\n- 50\n  YajimaT.InoueR.MatsumotoM.YajimaM. (2011). Non-neuronal release of ACh plays a key role in secretory response to luminal propionate in rat colon.**J. Physiol.**589(Pt 4)953–962. 10.1113\/jphysiol.2010.199976\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/21135046)\n  - [CrossRef](https:\/\/doi.org\/10.1113\/jphysiol.2010.199976)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=T..%2BYajima&author=R..%2BInoue&author=M..%2BMatsumoto&author=M..%2BYajima&publication_year=2011&title=Non-neuronal%2Brelease%2Bof%2BACh%2Bplays%2Ba%2Bkey%2Brole%2Bin%2Bsecretory%2Bresponse%2Bto%2Bluminal%2Bpropionate%2Bin%2Brat%2Bcolon.&journal=J.+Physiol.&volume=589%28Pt+4%29&pages=953-962)\n- 51\n  ZhaiS.ZhuL.QinS.LiL. (2018). Effect of lactulose intervention on gut microbiota and short chain fatty acid composition of C57BL\/6J mice.**Microbiologyopen**7:e00612. 10.1002\/mbo3.612\n  \n  - [Pubmed Abstract](https:\/\/pubmed.ncbi.nlm.nih.gov\/29575825)\n  - [CrossRef](https:\/\/doi.org\/10.1002\/mbo3.612)\n  - [Google Scholar](http:\/\/scholar.google.com\/scholar_lookup?author=S..%2BZhai&author=L..%2BZhu&author=S..%2BQin&author=L..%2BLi&publication_year=2018&title=Effect%2Bof%2Blactulose%2Bintervention%2Bon%2Bgut%2Bmicrobiota%2Band%2Bshort%2Bchain%2Bfatty%2Bacid%2Bcomposition%2Bof%2BC57BL%2F6J%2Bmice.&journal=Microbiologyopen&volume=7)\n\nKeywords\n\nlactose, diarrhea, microbiota, SCFA, Na\\+\n\nCitation\n\nXue H, Zhang M, Ma J, Chen T, Wang F and Tang X (2020) Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon. *Front. Physiol.* 11:877. doi: [10\\.3389\/fphys.2020.00877](http:\/\/dx.doi.org\/10.3389\/fphys.2020.00877)\n\nReceived\n\n04 March 2020\n\nAccepted\n\n29 June 2020\n\nPublished\n\n29 July 2020\n\nVolume\n\n11 - 2020\n\nEdited by\n\nKusum K. Kharbanda, University of Nebraska Medical Center, United States\n\nReviewed by\n\nWaddah Alrefai, University of Illinois at Chicago, United States; Shubha Priyamvada, University of Illinois at Chicago, United States\n\nUpdates\n\nCopyright\n\n© 2020 Xue, Zhang, Ma, Chen, Wang and Tang.\n\nThis is an open-access article distributed under the terms of the [Creative Commons Attribution License (CC BY)](http:\/\/creativecommons.org\/licenses\/by\/4.0\/). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\n\n**\\***Correspondence:**** Hong Xue, [xuehong03@163.com](mailto:xuehong03@163.com); Fengyun Wang, [wfy811@163.com](mailto:wfy811@163.com); Xudong Tang, [txdly@sina.com.cn](mailto:txdly@sina.com.cn); [txdly@sina.com](mailto:txdly@sina.com)\n\nThis article was submitted to Gastrointestinal Sciences, a section of the journal Frontiers in Physiology\n\nDisclaimer\n\nAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.","meta_canonical":null}

3. Robots.txt Check

Query:

Response:

4. Spam/Ban Check

Query:

Response:

5. Seen Status Check

ℹ️ Skipped - page is already crawled

📄

INDEXABLE

✅

CRAWLED

11 days ago

🤖

ROBOTS ALLOWED

Page Info Filters

Filter	Status	Condition	Details
HTTP status	PASS	`download_http_code = 200`	HTTP 200
Age cutoff	PASS	`download_stamp > now() - 6 MONTH`	0.4 months ago
History drop	PASS	`isNull(history_drop_reason)`	No drop reason
Spam/ban	PASS	`fh_dont_index != 1 AND ml_spam_score = 0`	ml_spam_score=0
Canonical	PASS	`meta_canonical IS NULL OR = '' OR = src_unparsed`	Not set

Page Details

Property	Value
URL	https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full
Last Crawled	2026-04-04 17:41:08 (11 days ago)
First Indexed	2024-10-30 13:01:30 (1 year ago)
HTTP Status Code	200
Meta Title	Frontiers \| Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon
Meta Description	Diarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the e..., Diarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the e...
Meta Canonical	null
Boilerpipe Text	Abstract Diarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the epithelial ion transport in lactose-induced diarrhea remain unclear. The present study aimed to investigate the effect of an incremental high-lactose diet (IHLD, 30%/40%/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. Gut microbiota were analyzed by 16S rRNA amplicon sequencing and the concentration of SCFAs by gas chromatography, galactose, lactose and lactic acid through assay kit; Ussing chamber was performed to detect basal and stimulated ion transport; The expression and location of SCFA transporters, the Na-H exchanger 3(NHE3), cystic fibrosis transporter regulater (CFTR) and NKCC1 in the colon mucosa were analyzed by western and immunostaining. The concentrations of lactose, galactose and lactic acid of the cecal content were markedly increased ( P < 0.01) and SCFA concentration was significantly decreased ( P < 0.01). This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and increased relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. The expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels, and decreases in delta basal short circuit current after apical Na + removal in the colonic mucosa of the IHLD group contributed to Na + accumulation in the lumen and decrease stimulated Cl – secretion with low CFTR and NKCC1 expression would compensate for water and electrolyte loss during the diarrhea process. These results indicated that the persistence of the diarrhea state was maintained by abnormal colonic microbiota fermentation leading to high concentrations of lactose, galactose and lactic acid and low SCFAs in the lumen, and decreased Na + absorption with the low NHE3 expression and phosphorylation levels. Introduction Diarrhea is a highly prevalent and bothersome disorder, particularly in children and the elderly. According to the WHO, it is estimated that 577,000 children aged <5 years and 502,000 adults aged >70 years will die from diarrheal diseases worldwide ( Thapar and Sanderson, 2004 ; Bryce et al., 2005 ; Wardlaw et al., 2010 ). Long-standing diarrhea causes malnutrition, which in turn leads to more difficulty in treating. Approximately 70% of the world’s population has hypolactasia after weaning, resulting in lactose malabsorption or lactose intolerance, defined as the presence of gastrointestinal symptoms such as bloating, rumbling, abdominal pain, nausea and diarrhea ( Swagerty et al., 2002 ; Bayless et al., 2017 ; Fassio et al., 2018 ). As we know, lactose intolerance-induced diarrhea belongs to osmotic diarrhea, thereby resulting in colonic water and electrolyte accumulation ( Hammer and Hammer, 2012 ). It is believed that the osmotic load is not only caused by undigested lactose but that the colonic fermentation capacity plays a role in lactose intolerance ( He et al., 2006 ). Lactose is fermented by the colonic resident microbiota into a series of intermediate and end-product metabolites, including lactate, formate, succinate and short-chain fatty acids (SCFAs), including acetate, propionate and butyrate ( He et al., 2006 ; Windey et al., 2015 ). Some reports have indicated that the osmolality of lactose-induced diarrhea is closely linked to the lactose content and the production of SCFAs in the colon ( Binder, 2010 ; Alexandre et al., 2013 ). SCFAs are the main anions of the colon, which have been demonstrated to be novel regulators of colonic ion transport ( Yajima et al., 2011 ; Kaji et al., 2016 ). Therefore, we speculated that the mechanism of lactose-induced diarrhea involved a change in SCFAs or lactate leading to a disturbance in colonic epithelial ion transport resulting in diarrhea. In the process of the transport of SCFAs, monocarboxylate (MCT1) and sodium MCT1 (sMCT1) transporters play an important role in mediating SCFA influx into the blood from the lumen ( Ritzhaupt et al., 1998 ; Ganapathy et al., 2005 ; Sivaprakasam et al., 2017 ). It is commonly recognized that diarrhea results from excessive secretion and/or impaired absorption of fluid and electrolytes across the intestinal epithelium. Excessive fluid secretion is caused by active chloride secretion into the intestinal lumen, which drives secondary movement of sodium and water ( Binder et al., 1991 ; Hoque et al., 2012 ). Chloride secretion involves the activation of chloride channel(s), such as CFTR, on the apical plasma membrane, and it is transported into the cell at the basolateral membrane by a Na/K/Cl symporter (NKCC1, also known as SLC12A2) ( Kunzelmann and Mall, 2002 ). Na + absorption includes electrogenic Na + absorption mediated by epithelial Na + channels (ENaC), whereas electroneutral Na + absorption is mediated by the Na-H exchanger (NHE) and Cl – -HCO 3 - exchanger (an anion exchanger; AE) ( Binder et al., 1987 ). NHE3 mediates both HCO 3 -dependent and butyrate-dependent Na + absorption in the normal gut, which is regulated by butyrate ( Subramanya et al., 2007 ), inducing NHE3 expression and increasing Na + absorption in the rat colon ( Musch et al., 2001 ; Vidyasagar and Ramakrishna, 2002 ). Although some studies demonstrated that undigested lactose and SCFAs induce diarrhea secondary to osmotically induced accumulation of ions and water in the colon ( Christopher and Bayless, 1971 ; Hammer et al., 1989 ), the change in the large intestinal luminal environment and disorder of the epithelial ion transport mechanism of lactose-induced chronic diarrhea remained unclear. Therefore, the objective of the study was to investigate the effect of an incremental high-lactose diet (IHLD, 30%/40%/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbiota and Na + absorption. Materials and Methods Animals and Diarrhea Induction Using an Incremental High Lactose Diet The experimental procedures followed the guidelines and practices of the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). The procedures were conducted in accordance with the Beijing Administration Office Committee of Laboratory Animals. Male Wistar rats (350–400 g) were housed under an artificial 12 h light-12 dark cycle (lights on at 08:00 h). Forty rats were fed a standard chow diet ad libitum and had free access to water for 4 days prior to the induction of diarrhea. Then, all rats were randomly divided into 4 groups of 10 animals each. The control group was fed a standard chow diet; the 30% lactose group was fed 30% lactose for 3 weeks; the 40% lactose group was fed 40% lactose for 3 weeks; and the IHLD group was fed 30–40–50% IHLD, which consisted of 30% lactose for the first week, 40% lactose for the second week and 50% lactose for the third week ( Figure 1 ). An IHLD containing 30, 40, and 50% lactose in place of starch was fed to rats (Keao Xieli Feed Co Ltd., Beijing). Rats were monitored for changes in the consistency of pellets and stool mass and fecal fluid. Rats were considered diarrheic if they produced watery, soft, yellowish stools compared to normal, pliable, soft, well-formed pellets as previously described by other researchers ( Boakye et al., 2012 ). FIGURE 1 DNA Extraction and PCR Amplification Cecal microbiota DNA was extracted using the Omega Stool DNA Kit (Qiagen, United States) and applied to amplification of the V3-V4 region of 16S rDNA with the gene-specific primers ACTCCTACGGGAGGCAGCAG and GGACTACHVGGGTWTCTAAT.PCR reactions were performed on a Mastercycler Gradient (Eppendorf, Germany) using 25 μl reaction volumes containing 12.5 μl of 2× Taq Plus Master Mix, 1 μl of forward primer (5 μM), 1 μl of reverse primer (5 μM), 3 μL of BSA (2 ng/μL), 5 μl of DNA (total template quantity is 30 ng), and 2.5 μl of ddH 2 O. PCR amplification was as follows: initiation at 94°C for 5 min, followed by 28 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, with a final extension of 72°C for 7 min. Three PCR products per sample were pooled to mitigate reaction-level PCR biases. The PCR products were purified using a QIAquick Gel Extraction Kit (QIAGEN, Germany), quantified using Real Time PCR, and sequenced at Allwegene Company, Beijing. High-Throughput Sequencing Deep sequencing was performed on the MiSeq platform at Allwegene Company (Beijing). After the run, image analysis, base calling and error estimation were performed using Illumina Analysis Pipeline Version 2.6. Data Analyses The raw data were first screened, and sequences were removed from consideration if they were shorter than 200 bp, had a low quality score (≤20), contained ambiguous bases or did not exactly match primer sequences and barcode tags. Qualified reads were separated using the sample-specific barcode sequences and trimmed with Illumina Analysis Pipeline Version 2.6. Then, the dataset was analyzed using QIIME. The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97% ( Edgar, 2013 ) to generate rarefaction curves and to calculate the richness and diversity indices. The Ribosomal Database Project (RDP) Classifier tool was used to classify all sequences into different taxonomic groups ( Cole et al., 2009 ). To examine the similarity between different samples, clustering analyses and PCA were used based on the OTU information from each sample using R ( Wang et al., 2012 ). The evolution distances between microbial communities from each sample were calculated using the tayc coefficient and represented as an Unweighted Pair Group Method with Arithmetic Mean (UPGMA) clustering tree describing the dissimilarity (1-similarity) between multiple samples ( Jiang et al., 2013 ). A Newick-formatted tree file was generated through this analysis. To compare the membership and structure of communities in different samples, heat maps were generated with the top 20 OTUs using Mothur ( Jami et al., 2013 ). SCFA, Lactose, Galactose and Lactic Acid Quantity The cecal contents were simply sampled in sterile tubes. Samples were kept frozen at −80°C until analysis. The samples were removed from the freezer, and 1,200 μL of water was added to each thawed sample. The samples were vortexed for 1 min until the material was homogenized. The SCFA content was determined by gas chromatography. Chromatographic analysis was carried out using an Agilent GC system with a flame ionization detector (FID) (Shimadzu Corp, Kyoto, Japan). Fused silica capillary columns 30 m × 0.25 mm coated with 0.25 μm film thickness were used. Nitrogen was used as the carrier gas. The oven temperature was 250°C, and the FID and injection port were set to 300 and 250°C, respectively. The injected sample volume was 1 μL, and the run time for each analysis was 32 min. The chromatograms and data integration were carried out using a Shimadzu C-R5A Chromatopac. The method was performed according to reference ( David et al., 2014 ). Lactose, galactose and lactic acid were detected by corresponding assay kits (ELAC-100, EGAL-100 and ECLC-100, respectively, Bioassay Systems, Hayward, CA, United States) according to the instructions. An aliquot of 50 mg of cecal and proximal colon content samples was dissolved in deionized water, vortexed for 20 s and centrifuged at 12,000 × g for 10 min at 4°C. The supernatant was eluted from HLB cartridges and evaporated to dryness under a nitrogen stream. Then, 50 μl of deionized water was added to the tube and redissolved. Ussing Chamber Experiments The distal colon was cut longitudinally along the mesenteric border. The serosa, muscularis and submucosa layers were stripped away with fine forceps to prepare a mucosa sample. Stripped mucosa was mounted in a modified Ussing Chamber in a tissue holder (Easy Mount Chamber; Physiologic Instruments, San Diego, CA, United States) with an aperture surface area of 0.3 cm 2 . Each sample was bathed bilaterally in Krebs-Henseleit solution (KHS). A short-circuit current was measured in vitro in Ussing chambers. Transepithelial PD was then clamped at 0 mV, and the short-circuit current ( I SC ) was recorded with a VCCMC6 voltage-current clamp amplifier (Physiologic Instruments, San Diego, CA, United States). Transepithelial resistance (TR) (Ω ∗ cm 2 ) was measured by altering the membrane potential in a stepwise fashion (0.1 mV) and calculated from the ohmic relationship. Solutions and Chemicals Krebs-Henseleit solution (KHS) (mmol/L): NaCl, 117; KCl, 4.7; MgCl 2 , 1.2; KH 2 PO 4 , 1.2; NaHCO 3 , 24.8; CaCl 2 , 2.5; and glucose, 11.1. The solution was bubbled with 95% O 2 and 5% CO 2 to maintain a pH value of 7.4. Na + free: NMDGCl 117; KCl 4.7; MgCl 2 .6H 2 O 1.2; KH 2 PO 3 1.2; choline HCO 3 25; CaCl 2 .2H 2 O 2.56; GS 11.1. The indomethacin, tetrodotoxin (TTX), DPC, amiloride, and forskolin, were purchased from Sigma (St. Louis, MO, United States). Stock solutions of all the above chemicals were dissolved in DMSO. The final DMSO concentration never exceeded 0.1% (v/v). Preliminary experiments indicated that the vehicle did not alter any baseline electrophysiological parameters. Western Blotting Tissue samples were collected from the colon mucosa of the control and high-lactose diets. Tissues were homogenized and sonicated in cold lysis buffer with protein inhibitiors and phosphatase inhibitors (Beyotime Biotechnology, Beijing). After 30 min standing in 4°C, the samples were then centrifuged at 12,000 × g for 30 min at 4°C. The pellets were discarded, and the supernatant was used for blotting. The proteins (50 μg) were separated via 8 or 10% SDS/PAGE. The blot was washed with Tris-buffered saline containing Tween-20 (TBST) and incubated overnight at 4°C with polyclonal primary antibodies against MCT1, sMCT1, NKCC1, and CFTR ( Supplementary Table S1 ) and the rabbit polyclonal anti-actin antibody ( Supplementary Table S1 ). After washing with TBST, the membranes were incubated with secondary antibodies ( Supplementary Table S1 ). Immunostaining The specimens were fixed with 4% paraformaldehyde for 10 min at 25°C, rinsed three times, and incubated with blocking serum for 1 h and anti-MCT, anti-sMCT1, anti-NHE3, anti-NKCC1 and anti-CFTR antibodies overnight at 4°C. After washing with PBS, the specimens were incubated with secondary antibodies. All antibodies in the experiments were shown in the Supplementary Material ( Supplementary Table S1 ). Images were obtained using a fluorescence microscope (Leica DM2500, Germany) with 20× or 40× dry lens. Statistical Analyses All data are presented as the mean ± SEM. Differences between three groups were evaluated using ANOVA with Prism software (version 9.1, SAS Institute, Inc.), and those between two groups were assessed using the t -test. The Wilcoxon t -test was used to compare microbial communities between two groups. Principal component analysis (PCA) plots of bacterial populations were created using Metaboanalyst 3.0. LEfSe analysis of the treatment group was performed on the basis of the results of the Wilcoxon tests, and the threshold on the logarithmic linear discriminant analysis (LDA) score was 3. Significance was defined as P < 0.05. Results Effect of IHLD-Induced Diarrhea on the Fecal Form, Fecal Fluid Content and Weight After 30% lactose administration for 48 h, we observed that the majority of rats began to produce wet, loose and yellowish stools. On the 7th day and 14th day, we changed to 40 and 50% lactose and found profuse, watery stools visibly containing lots of mucus with or without a structural pellet form ( Table 1 ). Compared to 30% lactose for 3 weeks, the graded increase in the concentration of lactose avoided the adaptation of rats to lactose and exhibited considerably more diarrhea than the same concentration of 30% lactose for 3 weeks. From our data, IHLD-fed rats could induce persistent and chronic diarrhea compared with only 30 or 40% lactose for 3 weeks, which can avoid adaptation to lactose in rats ( Table 1 ). In the first week, the majority of diarrheic rats (80 and 90%) showed severe diarrhea with profuse, watery stools containing mucus after 30 and 40% lactose diet. In the 3rd week, the fecal characteristics of most rats in the 30 or 40% lactose group showed loose and soft stool pellets, suggesting that diarrhea began to improve. 20% of rats in the IHLD group produced profuse, loose, wet and mucoid stools, and 40% of rats in the IHLD group produced many loose, yellowish, wet stools with or without the structural form of pellets. TABLE 1 Diets Form of stool after 48 h to 21st day Watery diarrhea + mucous (incontinence or profuse) Loose stools + mucous (non-structural stool) Loose stool with structural form of pellet Soft formed pellets Hardened normal pellets Standard chow diet – – – ++ ++++ 30% lactose diet 1st w +++ ++ + + – 40% lactose diet 1st w ++++ ++++ – – – IHLD 1st w +++ ++ + + – 30% lactose diet 2nd w – + + + – 40% lactose diet 2nd w ++ ++ ++ – – IHLD 2rd w + ++ + + – 30% lactose diet 3rd w + – ++ ++ + 40% lactose diet – + ++ + – 3rd w IHLD 3rd w + + ++ + – Comparison of the severity of diarrhea after single high lactose (30 or 40%) or incremental high lactose diet (30%/40%/50%) feeding for 3 weeks. IHLD: incremental high-lactose diet 1st w: the first week, 2nd w: second week, 3rd w: third week. Qualitative assessment score or classification: – condition not observed, + is the observed once/day; ++ is the observed twice/day. +++ is the observed 3–4 times/day, ++++ is the abundantly observed and +++++ is the almost exclusively observed. The IHLD caused a significant increase in fecal fluid content, as fluid content constituted 79% of stool mass compared with 16% in pellets produced by rats fed the standard diet ( Figure 2A ; P < 0.001). Furthermore, IHLD significantly decreased the fecal pH value compared with that of control rats ( Figure 2B , P < 0.001). In addition, an IHLD significantly decreased weight ( Figure 2C ), similar to previous studies ( Liuzzi and Hevia, 1998 ; Boakye et al., 2012 ). The everyday average food consumption and water intake were mildly decreased compared to those of the control group ( Figures 2D,E ). The average urine volume were almost same among the four groups ( Figure 2F ). FIGURE 2 Microbial Dysbiosis After Incremental High-Lactose Diet Incremental high-lactose diet induced significant alterations in the composition of the luminal microbiota of the cecum by 16S rRNA-Amplicon sequencing. A total of 14 samples from the two groups were analyzed by high-throughput pyrosequencing, which generated 1,133,201 clean tags. After IHLD, the Shannon and Chao 1 indexes revealed that the diversity and richness of the microbial communities were significantly lower than those in the control group ( Figure 3A ). Briefly, the results of PCA (Principal component analysis) showed that the composition of the luminal microbiota of IHLD formed a totally different cluster in the ordination plot, suggesting that IHLD caused major changes in the gut microbiome profiles ( Figure 3B ). FIGURE 3 Univariate analysis (LDA effect size) was performed to identify the key phyla and genera that exhibited large alterations in microbial composition after IHLD ( Figure 4A ). At the phylum level, the abundance of Bacteroidetes (16.54% versus 0.029%) and Verrucomicrobia (1.01% versus 0.0036%) significantly decreased, whereas that of Proteobacteria significantly increased after IHLD (0.58% versus 6.28%) ( Figure 4B and Supplementary Table S2 ). At the genus level, the abundance of 139 genera showed significant differences between the two groups. The IHLD group showed a marked increase compared to the control group in the relative abundances of Bifidobacterium (0.004% versus 1.12%), Escherichia-Shigella (0.02% versus 5.7%), Megamonas (0.23% versus 20.33%), and Lactobacillus (21.85% versus 70.85%) ( Figure 4B and Supplementary Table S2 ). In contrast, the concentrations of 59 genera were decreased to zero in the IHLD group, as shown in the Supplementary Table S2 , including SCFA-producing bacteria such as Ruminococcaceae UCG-013 ( Figure 4C ), Lachnospiraceae UCG-001 and Lachnospiraceae FCS020 group, also including lactose-fermenting Roseburia species increased by administration of a highly purified short-chain galactooligosaccharide (GOS) ( Azcarate-Peril et al., 2017 ). FIGURE 4 Correlation analyses were performed to identify the relationships between microbial genera and lactose fermentation products including lactose, galactose, lactate and SCFAs. The results showed the relative abundances of four genera, including Lactobacillus, Bifidobacterium, Megamonas and Escherichia Shigella, showing a strong relationship with lactose, galactose and lactate ( Figure 5 ). Among them, the relative abundance of lactobacilli, as the best-known lactic acid-producing bacteria, was 3.3-fold higher in IHLD than in the control. Another 16 genera, especially Allobaculum, Akkermansia, Lactobacillus, Bifidobacterium, and Bacteroides, with very low relative abundances showed a close association with the concentration of SCFAs. FIGURE 5 SCFA, Lactose, Galactose and Lactic Acid Quantification in the Cecal Luminal Contents The SCFA concentration is high in the cecum and proximal colon since SCFAs are produced by microbial fermentation in the cecum ( Tan et al., 2014 ; Kuwahara et al., 2018 ). Therefore, we investigated the concentration of SCFAs in the cecum. Lactose, galactose, lactic acid and SCFAs were quantified in cecal contents in the control and model groups. Interestingly, a significant decrease in the concentration of SCFAs was observed in the intestinal contents in the IHLD group in contrast to the control group. Acetate, propionate and butyrate were 140% lower in the cecum in the model group than in the control group, as presented in Figures 6A,B , suggesting that SCFA production was lower in the colon. In contrast, lactose, galactose and lactic acid concentrations were 10-, 6-, and 15-fold higher in the IHLD group, respectively than in the control group ( Figure 6C ). The results suggested that the high concentrations of lactose, lactic acid and galactose in the colon lumen but not SCFAs led to hyperosmosis in the colon, which would be the major reason for diarrhea. FIGURE 6 Expression and Location of MCT and sMCT1 in the Colon of the IHLD Group and Control Group MCT1 is an H + -coupled transporter expressed in the apical membrane and basolateral membrane of the colonic epithelium ( Ritzhaupt et al., 1998 ; Kirat et al., 2009 ), mediating SCFA influx from the lumen and SCFA efflux into the blood ( Iwanaga et al., 2006 ). The western blot results showed that the expression level of MCT1 protein in the colon of the IHLD group was lower by 65% than that in the control group ( Figures 7A,B ). Moreover, the number and intensity of MCT1 immunopositive cells were greatly decreased in lactose-fed rats ( Figures 7E,F ) compared with control animals ( Figures 7C,D ), confirming the western blot results. FIGURE 7 sMCT1 is a Na + -coupled transporter expressed solely on the apical membrane of the colonic epithelium that mediates SCFA influx from the lumen ( Ritzhaupt et al., 1998 ; Kuwahara et al., 2018 ). The western blot results showed that the expression level of sMCT1 did not change in IHLD rats compared to the control rats, as shown in Figure 7A , consistent with the immunofluorescence results ( Figures 7G,H ). Involvement of Na + Absorption and Anion Secretion in the Colon of the IHLD-Induced Diarrhea Group In order to investigate the basal and stimulated ion transport in the colonic epithelium of the IHLD group, a Ussing Chamber experiment was performed. In short circuit current recording, the basal current represents a summation of all ionic currents across the epithelium ( Xue et al., 2007 ; Clarke, 2009 ). The basal I SC was lower in the IHLD-model group (IHLD: 48 ± 5.15 μA/cm 2 versus control: 108 ± 37.23 μA/cm 2 , n = 10, Figure 7A ). In apical Na + -free KHS, the basal I SC without apical Na + absorption in the colonic mucosa of the control group was similar to that of the IHLD group (IHDL: −86.42 ± 7.8 μA/cm 2 versus control: −89.69 ± 11.41 μA/cm 2 , n = 11). However, the Δbasal I SC (subtract the basal I SC in apical Na + -free KHS from the basal I SC in normal KHS) in the colonic mucosa of the IHLD group was significantly decreased (IHLD 134.4 ± 2.65 μA/cm 2 versus control: 197.8 ± 25.82 μA/cm 2 , n = 10, Figure 7A ), suggesting that Na + absorption was lower in the IHLD group. After apical treatment with the ENaC inhibitor amiloride, a similar inhibition of basal I SC was observed in the control and IHLD groups, excluding the ENaC involved in the ion transport of the IHLD group (IHLD: −6.54 ± 1.73 μA/cm 2 versus control: −6.98 ± 2.22 μA/cm 2 , Supplementary Figure S1 ). As Figure 8 shown, the results of western blotting and immunostaining showed that the level of total protein expression and phosphorylation of NHE3 protein-mediated Na + absorption in the colon were downregulated by 37 and 67% respectively, in the model group compared with the control group ( Figures 8B–G ), which was responsible for the low Na + absorption. FIGURE 8 Furthermore, the cAMP elevator forskolin (1 μM, basolateral)-induced I SC increase in the colon of the IHLD group was lower than that in the control group (IHLD: 128.3 ± 15.3 μA/cm 2 versus control: 201.4 ± 28.31 μA/cm 2 , Figure 9A ). The inhibition of basal I SC induced by apical treatment with a known CFTR inhibitor DPC (diphenylamine-2, 2′-dicarboxylic acid), was significantly higher in the control group than in the IHLD group, suggesting that CFTR-mediated Cl – secretion under basal conditions was decreased in the IHLD group compared with the control group (IHLD: −1.12 ± 1.74 μA/cm 2 versus control: −8.10 ± 2.14 μA/cm 2 , Supplementary Figure S1 ). The western blot and immunostaining results showed that the protein expression levels of NKCC1 and CFTR in the colonic mucosa were decrease by 50 and 24%,respectively, than those in the control group, contributing to the lower basal and stimulated ion secretion in the model group ( Figures 9B–G ). FIGURE 9 Discussion Lactose intolerance (LI) appears to be mainly associated with unabsorbed lactose in the small intestine passing into the colon and being metabolized by colonic bacteria to organic acids, including lactic acid and short-chain fatty acids. The organic acids escaping absorption by the colon remain in the colonic lumen and lead to osmotic diarrhea. Previous studies have shown that lactose-induced diarrhea results, in large part, from the combination of net fluid secretion by the stomach and small intestine and interference with net fluid absorption in the colon ( Christopher and Bayless, 1971 ; Hammer et al., 1989 ). In our study, we established a chronic diarrhea model using lactose with a gradual increase in concentration for 3 weeks to investigate the mechanism of high lactose-induced diarrhea on organic acid production and ion transport of the colonic epithelium and NHE3, CFTR and NKCC1 expression combined with epithelial locations, which are associated with Na + absorption and Cl – secretion. The concentrations of lactose, galactose and lactic acid in the cecum in the IHLD model group were higher than those in the control group, but the concentration of SCFAs was lower, suggesting that the major reason for hyperosmosis is due to high concentrations of lactose, galactose and lactic acid in the intestinal lumen, which could cause osmotic diarrhea. Furthermore, the concentration of lactic acid in the cecum content was much higher than that in the control group, which was responsible for the low pH in the feces. Adult rats, as mammals, have intestinal lactase activity that decreases quickly upon weaning, and research has shown that although residual lactase activity is present in adult rats, a high-lactose diet is poorly digested by adult rats ( Alexandre et al., 2013 ; van de Heijning et al., 2015 ). The increase in galactose in the cecum contents after chronic feeding with high lactose might be due to microbiota fermentation. As expected, our results showed that significant differences were observed in the composition of cecum microbiota via high-throughput MiSeq sequencing after IHLD. A previous study ( Francavilla et al., 2012 ) investigated the influence of lactose on the composition of the gut microbiota and the SCFAs of infants with cow’s milk allergy. Similar to our findings, lactose intake can induce an increase in Bifidobacteria and Lactobacilli and a decrease in the numbers of Bacteroides, Prevotella and Clostridia. In addition, we also found that the increased abundances of another two genera, Escherichia-shigella and Megamonas, were positively related to the concentrations of lactose, galactose and lactic acid and might be responsible for the IHLD-induced diarrhea. They also measured SCFA levels and found that the concentration of SCFA increased after addition of lactose, which was the opposite result of our study because of the differences between from infants and adults. In addition, we found the loss of important SCFA-producing microbes, such as lachnospiraceae NK4A136 group and ruminococcaceae UCG-005, after IHLD, which might lead to the lower concentration of luminal SCFAs, consistent with a recent study on a high-sugar diet ( Laffin et al., 2019 ). Another recent study ( Kamphuis et al., 2019 ) showed that oral gavage with lactose at a modest dose of 5 mg/day for 3 weeks did not induce alterations in the fecal microbiota of mice, which was different from our study because of the low dose of lactose without significant malabsorption. In our results, we found that the concentrations of SCFAs in the cecal contents of the model group was significantly decreased compared with that of the control group, which was different from a previous study that showed that an increase in SCFAs resulted in acute ingestion of lactose in vivo and in vitro ( He et al., 2006 ; Windey et al., 2015 ). Few studies have focused on the effect of chronic lactose intervention on SCFAs, and a recent study ( Zhai et al., 2018 ) found no significant difference in the SCFA concentration of feces after 3 weeks of lactulose intervention in mice, suggesting a different mechanism between acute and chronic ingestion. In the colon, SCFAs are absorbed by MCT1 and sMCT1 in the colon epithelium. Our results showed that an unaltered expression level and differential distribution of sMCT1 were observed between the control group and IHLD group. However, MCT1 expression was significantly decreased, showing that its low expression level might be caused by lower SCFAs in the lumen, which is also reported to be regulated by butyrate ( Borthakur et al., 2008 , 2012 ). Currently, there is growing evidence indicating that SCFAs are a product of bacterial fermentation involved in the regulation of ion transport ( Yajima et al., 2011 ; Tan et al., 2014 ; Kuwahara et al., 2018 ). Previous studies demonstrated that luminal addition of propionate stimulates chloride secretion, which function as a lubricant for the movement of luminal contents in the colon ( Yajima et al., 2011 ). It has been reported that NHE3 mediates Na + absorption in the colon, and our data showed that its expression and phosphorylation level were significantly decreased in the model group, confirming a decrease in Na + absorption. The results of the Ussing Chamber demonstrated that when apical Na + was removed, the delta basal I SC in the IHLD group was significantly decreased, suggesting that Na + absorption was involved in the basal current. It is generally accepted that the absorption of Na + and Cl – in the colon is mutually interdependent, electrically neutral by largely apical Na/H exchange and Cl/HCO 3 exchange processes, primarily involving the Na/H exchanger NHE3 and the Cl/HCO 3 exchanger ( Walker et al., 2008 ). The evidence from the present study showed that Na + absorption and NHE3 protein expression and phosphorylation were decreased in IHLD rats compared with control rats, but the RNA level of NHE3 and the change in the expression of the Cl/HCO 3 exchanger involving Cl – absorption still need to be investigated. To the best of our knowledge, no previous report has found that NHE3 is involved in lactose-induced diarrhea and might be a novel target for the attenuation of lactose-induced diarrhea. In this study, we used the chronic diarrhea model induced by giving high lactose for 3 weeks, which could employ a compensatory mechanism to adapt to the diarrhea situation. A previous study showed that rats adapted to a lactose diet and that the size of the cecum returned to normal, but its mechanisms are not clear ( Lawrence et al., 1956 ; Szilagyi, 2015 ). Our results showed that basal current and FSK-induced Cl – secretion in the model group were lower than those in the control group, which can result in lower luminal anionic secretion and associated luminal transport of water. Furthermore, the NKCC1 and CFTR expression levels in the colon mucosa in the model group decreased compared with those in the control group, resulting in a decrease in basal and FSK-induced I SC . We considered it to have resulted from the compensatory mechanism. In the duodenum, luminal SCFAs induced HCO 3 - secretion ( Akiba et al., 2015 ). Our study showed that lower luminal SCFAs decrease Cl – secretion, but the mechanism should be investigated further. Taken together, IHLD feeding to rats caused a persistent state of diarrhea, and the cecum tripled in size. The concentrations of lactose, galactose and lactic acid were markedly increased in the cecal luminal contents, contributing to lactose intolerance-induced high osmosis diarrhea. Meanwhile, the lumen SCFA concentration of the cecal contents was significantly decreased. This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and an increase in the relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. In addition, the microbiota diversity in the colon was found to be lower in the cecum of IHLD rats compared with control rats. Concomitantly, the expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels in the colonic mucosa of the IHLD group contributed to the Na + absorption and accumulation decrease in the lumen, and the stimulated Cl – secretion decrease would be a compensatory effect for water and electrolyte loss during the diarrhea process ( Figure 10 ). The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbita and Na + absorption. FIGURE 10 Statements Ethics statement The animal study was reviewed and approved by the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). Author contributions HX, FW, and XT conceived the study. HX designed the experiment, wrote the manuscript, and performed the western blotting and immunostaining. MZ and JM made the animal models and performed the Ussing Chamber experiments. HX quantified SCFAs. HX and TC analyzed the data. FW and XT supervised the research. All authors contributed to the article and approved the submitted version. Funding This work was supported by the National Natural Science Foundation of China (Grant No. 81973838) and National Key Research and Development Project (Grant No. 2016YFC1302203). Acknowledgments The authors thank Prof. Wang Jiannong and Dr. Sun Caixia for their help for technical support on GC analyses for measuring SCFA levels. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Supplementary material The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphys.2020.00877/full#supplementary-material FIGURE S1 Comparison of effect of DPC or amiloride on the basal I SC current between control and IHLD group. Values are means ± SEM; P < 0.05. TABLE S1 Antibodies for western and immunofluorescence. TABLE S2 Information of statistical test analysis of phylum and genus level between control and IHLD group. References 1 Akiba Y. Inoue T. Kaji I. Narimatsu K. Iwamoto K. et al (2015). Short-chain fatty acid sensing in rat duodenum. J. Physiol. 593585–599. 10.1113/jphysiol.2014.280792 Pubmed Abstract CrossRef Google Scholar 2 Alexandre V. Even P. C. Larue A. C. Blouin J. M. Blachier F. Benamouzig R. et al (2013). Lactose malabsorption and colonic fermentations alter host metabolism in rats. Br. J. Nutr. 110625–631. 10.1017/S0007114512005557 Pubmed Abstract CrossRef Google Scholar 3 Azcarate-Peril M. A. Ritter A. J. Savaiano D. Monteagudo-Mera A. Anderson C. Magness S. T. (2017). Impact of the short-chain galactooligosaccharides on the gut microbiome of lactose-intolerant individuals. Proc. Natl. Acad. Sci. U.S.A. 114E367–E375. 10.1073/pnas.1606722113 Pubmed Abstract CrossRef Google Scholar 4 Bayless T. M. Brown E. Paige D. M. (2017). Lactase Non-persistence and Lactose Intolerance. Curr. Gastroenterol. Rep 19:23. 10.1007/s11894-017-0558-9 Pubmed Abstract CrossRef Google Scholar 5 Binder H. J. (2010). Role of Colonic Short-chain fatty acid transport in diarrhea. Annu. Rev. Physiol . 72297–313. 10.1146/annurev-physiol-021909-135817 Pubmed Abstract CrossRef Google Scholar 6 Binder H. J. Foster E. S. Budinger M. E. Hayslett J. P. (1987). Mechanism of electroneutral sodium chloride absorption in distal colon of the rat. Gastroenterology 93449–455. 10.1016/0016-5085(87)90905-x CrossRef Google Scholar 7 Binder H. J. Sandle G. I. Rajendran V. M. (1991). “Colonic fluid and electrolyte transport in health and disease,” in The Large Intestine: Physiology, Pathophysiology, and Disease , eds Phillips S. F. Pemberton J. H. Shorter R. G. (New York, NY: Raven Press), 141–168. Google Scholar 8 Boakye P. A. Brierley S. M. Balemba O. B. (2012). Garcinia buchananii bark extract is an effective anti-diarrheal remedy for lactose-induced diarrhea. J. Ethnopharmacol. 142539–547. 10.1016/j.jep.2012.05.034 Pubmed Abstract CrossRef Google Scholar 9 Borthakur A. Priyamvada S. Kumar A. Natarajan A. A. Gill R. K. Alrefai W. A. et al (2012). A novel nutrient sensing mechanism underlies substrate-induced regulation of monocarboxylate transporter 1. Am. J. Physiol. Gastrointest. Liver. Physiol. 303G1126–G1133. 10.1152/ajpgi.00308.2012 Pubmed Abstract CrossRef Google Scholar 10 Borthakur A. Saksena S. Gill R. K. Alrefai W. A. Ramaswamy K. Dudeja P. K. (2008). Regulation of monocarboxylate transporter 1 (MCT1) promoter by butyrate in human intestinal epithelial cells: Involvement of NF-κB pathway. J. Cell. Biochem. 1031452–1463. 10.1002/jcb.21532 Pubmed Abstract CrossRef Google Scholar 11 Bryce J. Boschi P. C. Shibuya K. Black R. E. (2005). WHO estimates of the causes of death in children. Lancet 3651147–1152. 10.1016/S0140-6736(05)71877-8 CrossRef Google Scholar 12 Christopher N. L. Bayless T. M. (1971). Role of the small bowel and colon in lactose-induced diarrhea. Gastroenterology 60845–852. 10.1016/s0016-5085(71)80083-5 CrossRef Google Scholar 13 Clarke L. L. (2009). A guide to Ussing chamber studies of mouse intestine. Am. J. Physiol. Gastrointest. Liver. Physiol. 296G1151–G1166. 10.1152/ajpgi.90649.2008 Pubmed Abstract CrossRef Google Scholar 14 Cole J. R. Wang Q. E. Cardenas J. Fish B. Chai R. J. Farris A. S. et al (2009). The ribosomal database project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 37D141–D145. 10.1093/nar/gkn879 Pubmed Abstract CrossRef Google Scholar 15 David L. A. Maurice C. F. Button J. E. Wolfe B. E. et al (2014). Diet rapidly and reproducibly alters the human gut microbiome. Nature 505559–563. 10.1038/nature12820 Pubmed Abstract CrossRef Google Scholar 16 Edgar R. C. (2013). UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat Methods 10996–998. 10.1038/nmeth.2604 Pubmed Abstract CrossRef Google Scholar 17 Fassio F. Facioni M. S. Guagnini F. (2018). Lactose maldigestion, malabsorption, and intolerance: a comprehensive review with focus on current management and future perspectives. Nutrients 10:1599. 10.3390/nu10111599 Pubmed Abstract CrossRef Google Scholar 18 Francavilla R. Calasso M. Calace L. Siragusa S. Ndagijimana M. Vernocchi P. et al (2012). Effect of lactose on gut microbiota and metabolome of infants with cow’s milk allergy. Pediatr. Allergy Immunol. 3420–427. 10.1111/j.1399-3038.2012.01286.x Pubmed Abstract CrossRef Google Scholar 19 Ganapathy V. Gopal E. Miyauchi S. Prasad P. D. (2005). Biological functions of SLC5A8,candidate tumour suppressor. Biochem. Soc. Trans. 33(Pt 1)237–240. 10.1042/BST0330237 Pubmed Abstract CrossRef Google Scholar 20 Hammer H. F. Hammer J. (2012). Diarrhea caused by carbohydrate malabsorption. Gastroenterol. Clin. N. Am. 41611–627. 10.1016/j.gtc.2012.06.003 Pubmed Abstract CrossRef Google Scholar 21 Hammer H. F. Santa Ana C. A. Schiller L. R. Fordtran J. S. (1989). Studies of osmotic diarrhea induced in normal subjects by ingestion of polyethylene glycol and lactulose. J. Clin. Invest. 841056–1062. 10.1172/JCI114267 Pubmed Abstract CrossRef Google Scholar 22 He T. Priebe M. G. Harmsen H. J. Stellaard F. Sun X. Welling G. W. et al (2006). Colonic fermentation may play a role in lactose intolerance in humans. J. Nutr. 13658–63. 10.1093/jn/136.1.58 Pubmed Abstract CrossRef Google Scholar 23 Hoque K. M. Chakraborty S. Sheikh I. A. Woodward O. M. (2012). New advances in the pathophysiology of intestinal ion transport and barrier function in diarrhea and the impact on therapy. Expert Rev. Anti Infect. Ther. 10687–699. 10.1586/eri.12.47 Pubmed Abstract CrossRef Google Scholar 24 Iwanaga T. Takebe K. Kato I. Karaki S. Kuwahara A. (2006). Cellular expression of monocarboxylate transporters (MCT) in the digestive tract of the mouse, rat, and humans, with special reference to slc5a8. Biomed. Res. 27243–254. 10.2220/biomedres.27.243 Pubmed Abstract CrossRef Google Scholar 25 Jami E. Israel A. Kotser A. Mizrahi I. (2013). Exploring the bovine rumen bacterial community from birth to adulthood. ISME J . 71069–1079. 10.1038/ismej.2013.2 Pubmed Abstract CrossRef Google Scholar 26 Jiang X. T. Peng X. Deng G. H. Sheng H. F. Wang Y. Zhou H. W. (2013). Illumina sequencing of 16S rRNA Tag revealed spatial variations of bacterial communities in a mangrove wetland. Microb. Ecol. 6696–104. 10.1007/s00248-013-0238-8 Pubmed Abstract CrossRef Google Scholar 27 Kaji I. Akiba Y. Konno K. Watanabe M. Kimura S. Iwanaga T. (2016). Neural FFA3 activation inversely regulates anion secretion evoked by nicotinic ACh receptor activation in rat. J. Physiol. 5943339–3352. 10.1113/JP271441 Pubmed Abstract CrossRef Google Scholar 28 Kamphuis J. B. J. Guiard B. Leveque M. Olier M. Jouanin I. Yvon S. et al (2019). Lactose and fructo-ligosaccharides increase visceral sensitivity in mice via glycation processes, increasing mast cell density in colonic mucosa. Gastroenterology 158652–663.e6. 10.1053/j.gastro.2019.10.037652663e6 CrossRef Google Scholar 29 Kirat D. Kondo K. Shimada R. Kato S. (2009). Dietary pectin up-regulates monocaboxylate transporter1 in the rat gastrointestinal tract. Exp. Physiol. 94422–433. 10.1113/expphysiol.2009.046797 Pubmed Abstract CrossRef Google Scholar 30 Kunzelmann K. Mall M. (2002). Electrolyte transport in the mammalian colon: mechanisms and implications for disease. Physiol Rev. 82245–289. 10.1152/physrev.00026.2001 Pubmed Abstract CrossRef Google Scholar 31 Kuwahara A. Kuwahara Y. Inui T. Marunaka Y. (2018). Regulation of ion transport in the intestine by free fatty acid receptor 2 and 3: possible involvement of the diffuse chemosensory system. Int. J. Mol. Sci. 19:735. 10.3390/ijms19030735 Pubmed Abstract CrossRef Google Scholar 32 Laffin M. Fedorak R. Zalasky A. Park H. Gill A. Agrawal A. (2019). A high-sugar diet rapidly enhances susceptibility to colitis via depletion of luminal short-chainfatty acids in mice. Sci. Rep. 9:12294. 10.1038/s41598-019-48749-2 Pubmed Abstract CrossRef Google Scholar 33 Lawrence J. V. Fischer J. E. Sutton T. S. Weiser H. H. (1956). Adaptation of the rat to a higher lactose diet, effect of the size of the cecum. Ohio J. Sci. 5687–92. Google Scholar 34 Liuzzi J. P. Hevia P. (1998). In well-fed young rats, lactose-induced chronic diarrhea reduces the apparent absorption of vitamins A and E and affects preferentially vitamin E status. J. Nutr. 1282467–2472. 10.1093/jn/128.12.2467 Pubmed Abstract CrossRef Google Scholar 35 Musch M. W. Bookstein C. Xie Y. Sellin J. H. Chang E. B. (2001). SCFA increase intestinal Na absorption by induction of NHE3 in rat colon and human intestinal C2/bbe cells. Am. J. Physiol. Gastrointest. Liver Physiol. 280G687–G693. 10.1152/ajpgi.2001.280.4.G687 Pubmed Abstract CrossRef Google Scholar 36 Ritzhaupt A. Wood I. S. Ellis A. Hosie K. B. Shirazi-Beechey S. P. (1998). Identification and characterization of a monocarboxylate transporter (MCT1) in pig and human colon: its potential to transport L-lactate as well as butyrate. J. Physiol. 513(Pt 3)719–732. 10.1111/j.1469-7793.1998.719ba.x Pubmed Abstract CrossRef Google Scholar 37 Sivaprakasam S. Bhutia Y. D. Yang S. Ganapathy V. (2017). Short-chain fatty acid transporters: role in colonic homeostasis. Compr. Physiol. 8299–314. 10.1002/cphy.c170014 Pubmed Abstract CrossRef Google Scholar 38 Subramanya S. B. Rajendran V. M. Srinivasan P. Nanda K. N. S. Binder H. J. (2007). Differential regulation of cholera toxin-inhibited Na-H exchange isoforms by butyrate in rat ileum. Am. J. Physiol. Gastrointest. Liver. Physiol. 293G857–G863. 10.1152/ajpgi.00462.2006 Pubmed Abstract CrossRef Google Scholar 39 Swagerty D. L. Jr. Walling A. D. Klein R. M. (2002). Lactose intolerance. Am. Fam. Physician. 651845–1850. Google Scholar 40 Szilagyi A. (2015). Adaptation to lactose in lactase non persistent people: Effects on intolerance and the relationship between Dairy Food consumption and evalution of diseases. Nutrients 76751–6779. 10.3390/nu7085309 Pubmed Abstract CrossRef Google Scholar 41 Tan J. McKenzie C. Potamitis M. Thorburn A. N. Mackay C. R. Macia L. (2014). The role of short-chain fatty acids in health and disease. Adv. Immunol. 12191–119. 10.1016/B978-0-12-800100-4.00003-9 Pubmed Abstract CrossRef Google Scholar 42 Thapar N. Sanderson I. R. (2004). Diarrhoea in children: an interface between developing and developed countries. Lancet 363641–653. 10.1016/S0140-6736(04)15599-2 CrossRef Google Scholar 43 van de Heijning B. J. Schipper L. Voogd E. Oosting A. van der Beek E. M. (2015). Acute and chronic effects of dietary lactose in adult rats are not explained by residual intestinal lactase activity. Nutrients 75542–5555. 10.3390/nu7075237 Pubmed Abstract CrossRef Google Scholar 44 Vidyasagar S. Ramakrishna B. S. (2002). Effects of butyrate on active sodium and chloride transport in rat and rabbit distal colon. J. Physiol. 539(Pt 1)163–173. 10.1113/jphysiol.2001.013056 Pubmed Abstract CrossRef Google Scholar 45 Walker N. M. Simpson J. E. Yen P. F. Gill R. K. Rigsby E. V. Brazill J. M. (2008). Down-regulated in adenoma Cl/HCO3 exchanger couples with Na/H exchanger 3 for NaCl absorptionin murine small intestine. Gastroenterology 1351645–1653. Google Scholar 46 Wang Y. Sheng H. F. He Y. Wu J. Y. Jiang Y. X. Tam N. F. (2012). Comparison of the levels of bacterial diversity in fresh water, intertidal wetland, and marine sediments by using millions of Illumina Tags. Appl. Environ. Microbiol. 78:8264. 10.1128/AEM.01821-12 Pubmed Abstract CrossRef Google Scholar 47 Wardlaw T. Salama P. Brocklehurst C. Chopra M. Mason E. (2010). Diarrhoea: why children are still dying and what can be done. Lancet 375870–872. 10.1016/S0140-6736(09)61798-0 CrossRef Google Scholar 48 Windey K. Houben E. Deroover L. Verbeke K. (2015). Contribution of colonic fermentation and fecal water toxicity to the pathophysiology of lactose-intolerance. Nutrients 77505–7522. 10.3390/nu7095349 Pubmed Abstract CrossRef Google Scholar 49 Xue H. Tian Y. M. Yan M. Yang N. Xing Y. et al (2007). Appearance of segmental discrepancy of anion transport in rat distal colon. Biol. Pharm. Bull. 301407–1411. 10.1248/bpb.30.1407 Pubmed Abstract CrossRef Google Scholar 50 Yajima T. Inoue R. Matsumoto M. Yajima M. (2011). Non-neuronal release of ACh plays a key role in secretory response to luminal propionate in rat colon. J. Physiol. 589(Pt 4)953–962. 10.1113/jphysiol.2010.199976 Pubmed Abstract CrossRef Google Scholar 51 Zhai S. Zhu L. Qin S. Li L. (2018). Effect of lactulose intervention on gut microbiota and short chain fatty acid composition of C57BL/6J mice. Microbiologyopen 7:e00612. 10.1002/mbo3.612 Pubmed Abstract CrossRef Google Scholar Keywords lactose, diarrhea, microbiota, SCFA, Na + Citation Xue H, Zhang M, Ma J, Chen T, Wang F and Tang X (2020) Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon. Front. Physiol. 11:877. doi: 10.3389/fphys.2020.00877 Received 04 March 2020 Accepted 29 June 2020 Published 29 July 2020 Volume 11 - 2020 Edited by Kusum K. Kharbanda, University of Nebraska Medical Center, United States Reviewed by Waddah Alrefai, University of Illinois at Chicago, United States; Shubha Priyamvada, University of Illinois at Chicago, United States Updates Copyright © 2020 Xue, Zhang, Ma, Chen, Wang and Tang. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) . The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. * Correspondence: Hong Xue, xuehong03@163.com ; Fengyun Wang, wfy811@163.com ; Xudong Tang, txdly@sina.com.cn ; txdly@sina.com This article was submitted to Gastrointestinal Sciences, a section of the journal Frontiers in Physiology Disclaimer All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.
Markdown	[![]() Frontiers in Physiology](https://www.frontiersin.org/journals/physiology) About us About us - Who we are - [Mission and values](https://www.frontiersin.org/about/mission) - [History](https://www.frontiersin.org/about/history) - [Leadership](https://www.frontiersin.org/about/leadership) - [Awards](https://www.frontiersin.org/about/awards) - Impact and progress - [Frontiers' impact](https://www.frontiersin.org/about/impact) - [Our annual reports](https://www.frontiersin.org/about/annual-reports) - [Thought leadership](https://www.frontiersin.org/about/thought-leadership) - Publishing model - [How we publish](https://www.frontiersin.org/about/how-we-publish) - [Open access](https://www.frontiersin.org/about/open-access) - [Peer review](https://www.frontiersin.org/about/peer-review) - [Research integrity](https://www.frontiersin.org/about/research-integrity) - [Research Topics](https://www.frontiersin.org/about/research-topics) - [FAIR² Data Management](https://www.frontiersin.org/about/fair-data-management) - [Fee policy](https://www.frontiersin.org/about/fee-policy) - Services - [Societies](https://publishingpartnerships.frontiersin.org/) - [National consortia](https://www.frontiersin.org/open-access-agreements/consortia) - [Institutional partnerships](https://www.frontiersin.org/about/open-access-agreements) - [Collaborators](https://www.frontiersin.org/about/collaborators) - More from Frontiers - [Frontiers Forum](https://forum.frontiersin.org/) - [Frontiers Planet Prize](https://www.frontiersin.org/about/frontiers-planet-prize) - [Press office](https://pressoffice.frontiersin.org/) - [Sustainability](https://www.frontiersin.org/about/sustainability) - [Career opportunities](https://careers.frontiersin.org/) - [Contact us](https://www.frontiersin.org/about/contact) [All journals](https://www.frontiersin.org/journals)[All articles](https://www.frontiersin.org/articles)[Submit your research](https://www.frontiersin.org/submission/submit?domainid=1&fieldid=65&specialtyid=0&entitytype=2&entityid=210) [Search](https://www.frontiersin.org/search?tab=top-results&origin=https%3A%2F%2Fwww.frontiersin.org%2Fjournals%2Fphysiology%2Farticles%2F10.3389%2Ffphys.2020.00877%2Ffull)[Login](https://www.frontiersin.org/people/login?returnUrl=https%3A%2F%2Fwww.frontiersin.org%2Fjournals%2Fphysiology%2Farticles%2F10.3389%2Ffphys.2020.00877%2Ffull) [![]() Frontiers in Physiology](https://www.frontiersin.org/journals/physiology) Sections Sections - [Aquatic Physiology](https://www.frontiersin.org/journals/physiology/sections/aquatic-physiology) - [Autonomic Neuroscience](https://www.frontiersin.org/journals/physiology/sections/autonomic-neuroscience) - [Avian Physiology](https://www.frontiersin.org/journals/physiology/sections/avian-physiology) - [Biophysics](https://www.frontiersin.org/journals/physiology/sections/biophysics) - [Cardiac Electrophysiology](https://www.frontiersin.org/journals/physiology/sections/cardiac-electrophysiology) - [Cell Physiology](https://www.frontiersin.org/journals/physiology/sections/cell-physiology) - [Chronobiology](https://www.frontiersin.org/journals/physiology/sections/chronobiology) - [Clinical and Translational Physiology](https://www.frontiersin.org/journals/physiology/sections/clinical-and-translational-physiology) - [Computational Physiology and Medicine](https://www.frontiersin.org/journals/physiology/sections/computational-physiology-and-medicine) - [Craniofacial Biology and Dental Research](https://www.frontiersin.org/journals/physiology/sections/craniofacial-biology-and-dental-research) - [Developmental Physiology](https://www.frontiersin.org/journals/physiology/sections/developmental-physiology) - [Environmental, Aviation and Space Physiology](https://www.frontiersin.org/journals/physiology/sections/environmental-aviation-and-space-physiology) - [Exercise Physiology](https://www.frontiersin.org/journals/physiology/sections/exercise-physiology) - [Gastrointestinal Sciences](https://www.frontiersin.org/journals/physiology/sections/gastrointestinal-sciences) - [Integrative Physiology](https://www.frontiersin.org/journals/physiology/sections/integrative-physiology) - [Invertebrate Physiology](https://www.frontiersin.org/journals/physiology/sections/invertebrate-physiology) - [Lipid and Fatty Acid Research](https://www.frontiersin.org/journals/physiology/sections/lipid-and-fatty-acid-research) - [Medical Physics and Imaging](https://www.frontiersin.org/journals/physiology/sections/medical-physics-and-imaging) - [Membrane Physiology and Membrane Biophysics](https://www.frontiersin.org/journals/physiology/sections/membrane-physiology-and-membrane-biophysics) - [Metabolic Physiology](https://www.frontiersin.org/journals/physiology/sections/metabolic-physiology) - [Mitochondrial Research](https://www.frontiersin.org/journals/physiology/sections/mitochondrial-research) - [Physio-logging](https://www.frontiersin.org/journals/physiology/sections/physio-logging) - [Red Blood Cell Physiology](https://www.frontiersin.org/journals/physiology/sections/red-blood-cell-physiology) - [Redox Physiology](https://www.frontiersin.org/journals/physiology/sections/redox-physiology) - [Renal Physiology and Pathophysiology](https://www.frontiersin.org/journals/physiology/sections/renal-physiology-and-pathophysiology) - [Reproductive and Mating Physiology](https://www.frontiersin.org/journals/physiology/sections/reproductive-and-mating-physiology) - [Respiratory Physiology and Pathophysiology](https://www.frontiersin.org/journals/physiology/sections/respiratory-physiology-and-pathophysiology) - [Skeletal Physiology](https://www.frontiersin.org/journals/physiology/sections/skeletal-physiology) - [Skin Physiology](https://www.frontiersin.org/journals/physiology/sections/skin-physiology) - [Striated Muscle Physiology](https://www.frontiersin.org/journals/physiology/sections/striated-muscle-physiology) - [Vascular Physiology](https://www.frontiersin.org/journals/physiology/sections/vascular-physiology) [Articles](https://www.frontiersin.org/journals/physiology/articles)[Research Topics](https://www.frontiersin.org/journals/physiology/research-topics)[Editorial board](https://www.frontiersin.org/journals/physiology/editors) About journal About journal - Scope - [Field chief editors](https://www.frontiersin.org/journals/physiology/about#about-editors) - [Mission & scope](https://www.frontiersin.org/journals/physiology/about#about-scope) - [Facts](https://www.frontiersin.org/journals/physiology/about#about-facts) - [Journal sections](https://www.frontiersin.org/journals/physiology/about#about-submission) - [Open access statement](https://www.frontiersin.org/journals/physiology/about#about-open) - [Copyright statement](https://www.frontiersin.org/journals/physiology/about#copyright-statement) - [Quality](https://www.frontiersin.org/journals/physiology/about#about-quality) - For authors - [Why submit?](https://www.frontiersin.org/journals/physiology/for-authors/why-submit) - [Article types](https://www.frontiersin.org/journals/physiology/for-authors/article-types) - [Author guidelines](https://www.frontiersin.org/journals/physiology/for-authors/author-guidelines) - [Editor guidelines](https://www.frontiersin.org/journals/physiology/for-authors/editor-guidelines) - [Publishing fees](https://www.frontiersin.org/journals/physiology/for-authors/publishing-fees) - [Submission checklist](https://www.frontiersin.org/journals/physiology/for-authors/submission-checklist) - [Contact editorial office](https://www.frontiersin.org/journals/physiology/for-authors/contact-editorial-office) About us About us - Who we are - [Mission and values](https://www.frontiersin.org/about/mission) - [History](https://www.frontiersin.org/about/history) - [Leadership](https://www.frontiersin.org/about/leadership) - [Awards](https://www.frontiersin.org/about/awards) - Impact and progress - [Frontiers' impact](https://www.frontiersin.org/about/impact) - [Our annual reports](https://www.frontiersin.org/about/annual-reports) - [Thought leadership](https://www.frontiersin.org/about/thought-leadership) - Publishing model - [How we publish](https://www.frontiersin.org/about/how-we-publish) - [Open access](https://www.frontiersin.org/about/open-access) - [Peer review](https://www.frontiersin.org/about/peer-review) - [Research integrity](https://www.frontiersin.org/about/research-integrity) - [Research Topics](https://www.frontiersin.org/about/research-topics) - [FAIR² Data Management](https://www.frontiersin.org/about/fair-data-management) - [Fee policy](https://www.frontiersin.org/about/fee-policy) - Services - [Societies](https://publishingpartnerships.frontiersin.org/) - [National consortia](https://www.frontiersin.org/open-access-agreements/consortia) - [Institutional partnerships](https://www.frontiersin.org/about/open-access-agreements) - [Collaborators](https://www.frontiersin.org/about/collaborators) - More from Frontiers - [Frontiers Forum](https://forum.frontiersin.org/) - [Frontiers Planet Prize](https://www.frontiersin.org/about/frontiers-planet-prize) - [Press office](https://pressoffice.frontiersin.org/) - [Sustainability](https://www.frontiersin.org/about/sustainability) - [Career opportunities](https://careers.frontiersin.org/) - [Contact us](https://www.frontiersin.org/about/contact) [All journals](https://www.frontiersin.org/journals)[All articles](https://www.frontiersin.org/articles)[Submit your research](https://www.frontiersin.org/submission/submit?domainid=1&fieldid=65&specialtyid=0&entitytype=2&entityid=210) [![]() Frontiers in Physiology](https://www.frontiersin.org/journals/physiology) Sections Sections - [Aquatic Physiology](https://www.frontiersin.org/journals/physiology/sections/aquatic-physiology) - [Autonomic Neuroscience](https://www.frontiersin.org/journals/physiology/sections/autonomic-neuroscience) - [Avian Physiology](https://www.frontiersin.org/journals/physiology/sections/avian-physiology) - [Biophysics](https://www.frontiersin.org/journals/physiology/sections/biophysics) - [Cardiac Electrophysiology](https://www.frontiersin.org/journals/physiology/sections/cardiac-electrophysiology) - [Cell Physiology](https://www.frontiersin.org/journals/physiology/sections/cell-physiology) - [Chronobiology](https://www.frontiersin.org/journals/physiology/sections/chronobiology) - [Clinical and Translational Physiology](https://www.frontiersin.org/journals/physiology/sections/clinical-and-translational-physiology) - [Computational Physiology and Medicine](https://www.frontiersin.org/journals/physiology/sections/computational-physiology-and-medicine) - [Craniofacial Biology and Dental Research](https://www.frontiersin.org/journals/physiology/sections/craniofacial-biology-and-dental-research) - [Developmental Physiology](https://www.frontiersin.org/journals/physiology/sections/developmental-physiology) - [Environmental, Aviation and Space Physiology](https://www.frontiersin.org/journals/physiology/sections/environmental-aviation-and-space-physiology) - [Exercise Physiology](https://www.frontiersin.org/journals/physiology/sections/exercise-physiology) - [Gastrointestinal Sciences](https://www.frontiersin.org/journals/physiology/sections/gastrointestinal-sciences) - [Integrative Physiology](https://www.frontiersin.org/journals/physiology/sections/integrative-physiology) - [Invertebrate Physiology](https://www.frontiersin.org/journals/physiology/sections/invertebrate-physiology) - [Lipid and Fatty Acid Research](https://www.frontiersin.org/journals/physiology/sections/lipid-and-fatty-acid-research) - [Medical Physics and Imaging](https://www.frontiersin.org/journals/physiology/sections/medical-physics-and-imaging) - [Membrane Physiology and Membrane Biophysics](https://www.frontiersin.org/journals/physiology/sections/membrane-physiology-and-membrane-biophysics) - [Metabolic Physiology](https://www.frontiersin.org/journals/physiology/sections/metabolic-physiology) - [Mitochondrial Research](https://www.frontiersin.org/journals/physiology/sections/mitochondrial-research) - [Physio-logging](https://www.frontiersin.org/journals/physiology/sections/physio-logging) - [Red Blood Cell Physiology](https://www.frontiersin.org/journals/physiology/sections/red-blood-cell-physiology) - [Redox Physiology](https://www.frontiersin.org/journals/physiology/sections/redox-physiology) - [Renal Physiology and Pathophysiology](https://www.frontiersin.org/journals/physiology/sections/renal-physiology-and-pathophysiology) - [Reproductive and Mating Physiology](https://www.frontiersin.org/journals/physiology/sections/reproductive-and-mating-physiology) - [Respiratory Physiology and Pathophysiology](https://www.frontiersin.org/journals/physiology/sections/respiratory-physiology-and-pathophysiology) - [Skeletal Physiology](https://www.frontiersin.org/journals/physiology/sections/skeletal-physiology) - [Skin Physiology](https://www.frontiersin.org/journals/physiology/sections/skin-physiology) - [Striated Muscle Physiology](https://www.frontiersin.org/journals/physiology/sections/striated-muscle-physiology) - [Vascular Physiology](https://www.frontiersin.org/journals/physiology/sections/vascular-physiology) [Articles](https://www.frontiersin.org/journals/physiology/articles)[Research Topics](https://www.frontiersin.org/journals/physiology/research-topics)[Editorial board](https://www.frontiersin.org/journals/physiology/editors) About journal About journal - Scope - [Field chief editors](https://www.frontiersin.org/journals/physiology/about#about-editors) - [Mission & scope](https://www.frontiersin.org/journals/physiology/about#about-scope) - [Facts](https://www.frontiersin.org/journals/physiology/about#about-facts) - [Journal sections](https://www.frontiersin.org/journals/physiology/about#about-submission) - [Open access statement](https://www.frontiersin.org/journals/physiology/about#about-open) - [Copyright statement](https://www.frontiersin.org/journals/physiology/about#copyright-statement) - [Quality](https://www.frontiersin.org/journals/physiology/about#about-quality) - For authors - [Why submit?](https://www.frontiersin.org/journals/physiology/for-authors/why-submit) - [Article types](https://www.frontiersin.org/journals/physiology/for-authors/article-types) - [Author guidelines](https://www.frontiersin.org/journals/physiology/for-authors/author-guidelines) - [Editor guidelines](https://www.frontiersin.org/journals/physiology/for-authors/editor-guidelines) - [Publishing fees](https://www.frontiersin.org/journals/physiology/for-authors/publishing-fees) - [Submission checklist](https://www.frontiersin.org/journals/physiology/for-authors/submission-checklist) - [Contact editorial office](https://www.frontiersin.org/journals/physiology/for-authors/contact-editorial-office) [![]() Frontiers in Physiology](https://www.frontiersin.org/journals/physiology) Sections Sections - [Aquatic Physiology](https://www.frontiersin.org/journals/physiology/sections/aquatic-physiology) - [Autonomic Neuroscience](https://www.frontiersin.org/journals/physiology/sections/autonomic-neuroscience) - [Avian Physiology](https://www.frontiersin.org/journals/physiology/sections/avian-physiology) - [Biophysics](https://www.frontiersin.org/journals/physiology/sections/biophysics) - [Cardiac Electrophysiology](https://www.frontiersin.org/journals/physiology/sections/cardiac-electrophysiology) - [Cell Physiology](https://www.frontiersin.org/journals/physiology/sections/cell-physiology) - [Chronobiology](https://www.frontiersin.org/journals/physiology/sections/chronobiology) - [Clinical and Translational Physiology](https://www.frontiersin.org/journals/physiology/sections/clinical-and-translational-physiology) - [Computational Physiology and Medicine](https://www.frontiersin.org/journals/physiology/sections/computational-physiology-and-medicine) - [Craniofacial Biology and Dental Research](https://www.frontiersin.org/journals/physiology/sections/craniofacial-biology-and-dental-research) - [Developmental Physiology](https://www.frontiersin.org/journals/physiology/sections/developmental-physiology) - [Environmental, Aviation and Space Physiology](https://www.frontiersin.org/journals/physiology/sections/environmental-aviation-and-space-physiology) - [Exercise Physiology](https://www.frontiersin.org/journals/physiology/sections/exercise-physiology) - [Gastrointestinal Sciences](https://www.frontiersin.org/journals/physiology/sections/gastrointestinal-sciences) - [Integrative Physiology](https://www.frontiersin.org/journals/physiology/sections/integrative-physiology) - [Invertebrate Physiology](https://www.frontiersin.org/journals/physiology/sections/invertebrate-physiology) - [Lipid and Fatty Acid Research](https://www.frontiersin.org/journals/physiology/sections/lipid-and-fatty-acid-research) - [Medical Physics and Imaging](https://www.frontiersin.org/journals/physiology/sections/medical-physics-and-imaging) - [Membrane Physiology and Membrane Biophysics](https://www.frontiersin.org/journals/physiology/sections/membrane-physiology-and-membrane-biophysics) - [Metabolic Physiology](https://www.frontiersin.org/journals/physiology/sections/metabolic-physiology) - [Mitochondrial Research](https://www.frontiersin.org/journals/physiology/sections/mitochondrial-research) - [Physio-logging](https://www.frontiersin.org/journals/physiology/sections/physio-logging) - [Red Blood Cell Physiology](https://www.frontiersin.org/journals/physiology/sections/red-blood-cell-physiology) - [Redox Physiology](https://www.frontiersin.org/journals/physiology/sections/redox-physiology) - [Renal Physiology and Pathophysiology](https://www.frontiersin.org/journals/physiology/sections/renal-physiology-and-pathophysiology) - [Reproductive and Mating Physiology](https://www.frontiersin.org/journals/physiology/sections/reproductive-and-mating-physiology) - [Respiratory Physiology and Pathophysiology](https://www.frontiersin.org/journals/physiology/sections/respiratory-physiology-and-pathophysiology) - [Skeletal Physiology](https://www.frontiersin.org/journals/physiology/sections/skeletal-physiology) - [Skin Physiology](https://www.frontiersin.org/journals/physiology/sections/skin-physiology) - [Striated Muscle Physiology](https://www.frontiersin.org/journals/physiology/sections/striated-muscle-physiology) - [Vascular Physiology](https://www.frontiersin.org/journals/physiology/sections/vascular-physiology) [Articles](https://www.frontiersin.org/journals/physiology/articles)[Research Topics](https://www.frontiersin.org/journals/physiology/research-topics)[Editorial board](https://www.frontiersin.org/journals/physiology/editors) About journal About journal - Scope - [Field chief editors](https://www.frontiersin.org/journals/physiology/about#about-editors) - [Mission & scope](https://www.frontiersin.org/journals/physiology/about#about-scope) - [Facts](https://www.frontiersin.org/journals/physiology/about#about-facts) - [Journal sections](https://www.frontiersin.org/journals/physiology/about#about-submission) - [Open access statement](https://www.frontiersin.org/journals/physiology/about#about-open) - [Copyright statement](https://www.frontiersin.org/journals/physiology/about#copyright-statement) - [Quality](https://www.frontiersin.org/journals/physiology/about#about-quality) - For authors - [Why submit?](https://www.frontiersin.org/journals/physiology/for-authors/why-submit) - [Article types](https://www.frontiersin.org/journals/physiology/for-authors/article-types) - [Author guidelines](https://www.frontiersin.org/journals/physiology/for-authors/author-guidelines) - [Editor guidelines](https://www.frontiersin.org/journals/physiology/for-authors/editor-guidelines) - [Publishing fees](https://www.frontiersin.org/journals/physiology/for-authors/publishing-fees) - [Submission checklist](https://www.frontiersin.org/journals/physiology/for-authors/submission-checklist) - [Contact editorial office](https://www.frontiersin.org/journals/physiology/for-authors/contact-editorial-office) [Submit your research](https://www.frontiersin.org/submission/submit?domainid=1&fieldid=65&specialtyid=0&entitytype=2&entityid=210)[Search](https://www.frontiersin.org/search?tab=top-results&origin=https%3A%2F%2Fwww.frontiersin.org%2Fjournals%2Fphysiology%2Farticles%2F10.3389%2Ffphys.2020.00877%2Ffull)[Login](https://www.frontiersin.org/people/login?returnUrl=https%3A%2F%2Fwww.frontiersin.org%2Fjournals%2Fphysiology%2Farticles%2F10.3389%2Ffphys.2020.00877%2Ffull) ## ORIGINAL RESEARCH article Front. Physiol., 29 July 2020 Sec. Gastrointestinal Sciences Volume 11 - 2020 \\| <https://doi.org/10.3389/fphys.2020.00877> ## ORIGINAL RESEARCH article Front. Physiol., 29 July 2020 Sec. Gastrointestinal Sciences Volume 11 - 2020 \\| <https://doi.org/10.3389/fphys.2020.00877> # Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon - [HXHong Xue \](https://loop.frontiersin.org/people/921458) - MZ Min Zhang - JM Jinxin Ma - TC Ting Chen - FW Fengyun Wang \ - XT Xudong Tang \* - Digestive Laboratory of Traditional Chinese Medicine Research Institute of Spleen and Stomach Diseases, Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing, China Article metrics [View details](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#metrics) ## Abstract Diarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the epithelial ion transport in lactose-induced diarrhea remain unclear. The present study aimed to investigate the effect of an incremental high-lactose diet (IHLD, 30%/40%/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. Gut microbiota were analyzed by 16S rRNA amplicon sequencing and the concentration of SCFAs by gas chromatography, galactose, lactose and lactic acid through assay kit; Ussing chamber was performed to detect basal and stimulated ion transport; The expression and location of SCFA transporters, the Na-H exchanger 3(NHE3), cystic fibrosis transporter regulater (CFTR) and NKCC1 in the colon mucosa were analyzed by western and immunostaining. The concentrations of lactose, galactose and lactic acid of the cecal content were markedly increased (P \< 0.01) and SCFA concentration was significantly decreased (P \< 0.01). This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and increased relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. The expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels, and decreases in delta basal short circuit current after apical Na\+ removal in the colonic mucosa of the IHLD group contributed to Na\+ accumulation in the lumen and decrease stimulated Cl– secretion with low CFTR and NKCC1 expression would compensate for water and electrolyte loss during the diarrhea process. These results indicated that the persistence of the diarrhea state was maintained by abnormal colonic microbiota fermentation leading to high concentrations of lactose, galactose and lactic acid and low SCFAs in the lumen, and decreased Na\+ absorption with the low NHE3 expression and phosphorylation levels. ## Introduction Diarrhea is a highly prevalent and bothersome disorder, particularly in children and the elderly. According to the WHO, it is estimated that 577,000 children aged \<5 years and 502,000 adults aged \>70 years will die from diarrheal diseases worldwide ([Thapar and Sanderson, 2004](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B42); [Bryce et al., 2005](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B11); [Wardlaw et al., 2010](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B47)). Long-standing diarrhea causes malnutrition, which in turn leads to more difficulty in treating. Approximately 70% of the world’s population has hypolactasia after weaning, resulting in lactose malabsorption or lactose intolerance, defined as the presence of gastrointestinal symptoms such as bloating, rumbling, abdominal pain, nausea and diarrhea ([Swagerty et al., 2002](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B39); [Bayless et al., 2017](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B4); [Fassio et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B17)). As we know, lactose intolerance-induced diarrhea belongs to osmotic diarrhea, thereby resulting in colonic water and electrolyte accumulation ([Hammer and Hammer, 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B20)). It is believed that the osmotic load is not only caused by undigested lactose but that the colonic fermentation capacity plays a role in lactose intolerance ([He et al., 2006](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B22)). Lactose is fermented by the colonic resident microbiota into a series of intermediate and end-product metabolites, including lactate, formate, succinate and short-chain fatty acids (SCFAs), including acetate, propionate and butyrate ([He et al., 2006](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B22); [Windey et al., 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B48)). Some reports have indicated that the osmolality of lactose-induced diarrhea is closely linked to the lactose content and the production of SCFAs in the colon ([Binder, 2010](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B5); [Alexandre et al., 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B2)). SCFAs are the main anions of the colon, which have been demonstrated to be novel regulators of colonic ion transport ([Yajima et al., 2011](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B50); [Kaji et al., 2016](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B27)). Therefore, we speculated that the mechanism of lactose-induced diarrhea involved a change in SCFAs or lactate leading to a disturbance in colonic epithelial ion transport resulting in diarrhea. In the process of the transport of SCFAs, monocarboxylate (MCT1) and sodium MCT1 (sMCT1) transporters play an important role in mediating SCFA influx into the blood from the lumen ([Ritzhaupt et al., 1998](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B36); [Ganapathy et al., 2005](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B19); [Sivaprakasam et al., 2017](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B37)). It is commonly recognized that diarrhea results from excessive secretion and/or impaired absorption of fluid and electrolytes across the intestinal epithelium. Excessive fluid secretion is caused by active chloride secretion into the intestinal lumen, which drives secondary movement of sodium and water ([Binder et al., 1991](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B7); [Hoque et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B23)). Chloride secretion involves the activation of chloride channel(s), such as CFTR, on the apical plasma membrane, and it is transported into the cell at the basolateral membrane by a Na/K/Cl symporter (NKCC1, also known as SLC12A2) ([Kunzelmann and Mall, 2002](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B30)). Na\+ absorption includes electrogenic Na\+ absorption mediated by epithelial Na\+ channels (ENaC), whereas electroneutral Na\+ absorption is mediated by the Na-H exchanger (NHE) and Cl–\-HCO−3 3 \- exchanger (an anion exchanger; AE) ([Binder et al., 1987](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B6)). NHE3 mediates both HCO3\-dependent and butyrate-dependent Na\+ absorption in the normal gut, which is regulated by butyrate ([Subramanya et al., 2007](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B38)), inducing NHE3 expression and increasing Na\+ absorption in the rat colon ([Musch et al., 2001](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B35); [Vidyasagar and Ramakrishna, 2002](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B44)). Although some studies demonstrated that undigested lactose and SCFAs induce diarrhea secondary to osmotically induced accumulation of ions and water in the colon ([Christopher and Bayless, 1971](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B12); [Hammer et al., 1989](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B21)), the change in the large intestinal luminal environment and disorder of the epithelial ion transport mechanism of lactose-induced chronic diarrhea remained unclear. Therefore, the objective of the study was to investigate the effect of an incremental high-lactose diet (IHLD, 30%/40%/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbiota and Na\+ absorption. ## Materials and Methods ### Animals and Diarrhea Induction Using an Incremental High Lactose Diet The experimental procedures followed the guidelines and practices of the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). The procedures were conducted in accordance with the Beijing Administration Office Committee of Laboratory Animals. Male Wistar rats (350–400 g) were housed under an artificial 12 h light-12 dark cycle (lights on at 08:00 h). Forty rats were fed a standard chow diet ad libitum and had free access to water for 4 days prior to the induction of diarrhea. Then, all rats were randomly divided into 4 groups of 10 animals each. The control group was fed a standard chow diet; the 30% lactose group was fed 30% lactose for 3 weeks; the 40% lactose group was fed 40% lactose for 3 weeks; and the IHLD group was fed 30–40–50% IHLD, which consisted of 30% lactose for the first week, 40% lactose for the second week and 50% lactose for the third week ([Figure 1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F1)). An IHLD containing 30, 40, and 50% lactose in place of starch was fed to rats (Keao Xieli Feed Co Ltd., Beijing). Rats were monitored for changes in the consistency of pellets and stool mass and fecal fluid. Rats were considered diarrheic if they produced watery, soft, yellowish stools compared to normal, pliable, soft, well-formed pellets as previously described by other researchers ([Boakye et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B8)). FIGURE 1 ![FIGURE 1](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g001.webp) Plan of experimental animal grouping showing the days for different diets feeding. ### DNA Extraction and PCR Amplification Cecal microbiota DNA was extracted using the Omega Stool DNA Kit (Qiagen, United States) and applied to amplification of the V3-V4 region of 16S rDNA with the gene-specific primers ACTCCTACGGGAGGCAGCAG and GGACTACHVGGGTWTCTAAT.PCR reactions were performed on a Mastercycler Gradient (Eppendorf, Germany) using 25 μl reaction volumes containing 12.5 μl of 2× Taq Plus Master Mix, 1 μl of forward primer (5 μM), 1 μl of reverse primer (5 μM), 3 μL of BSA (2 ng/μL), 5 μl of DNA (total template quantity is 30 ng), and 2.5 μl of ddH2O. PCR amplification was as follows: initiation at 94°C for 5 min, followed by 28 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, with a final extension of 72°C for 7 min. Three PCR products per sample were pooled to mitigate reaction-level PCR biases. The PCR products were purified using a QIAquick Gel Extraction Kit (QIAGEN, Germany), quantified using Real Time PCR, and sequenced at Allwegene Company, Beijing. ### High-Throughput Sequencing Deep sequencing was performed on the MiSeq platform at Allwegene Company (Beijing). After the run, image analysis, base calling and error estimation were performed using Illumina Analysis Pipeline Version 2.6. ### Data Analyses The raw data were first screened, and sequences were removed from consideration if they were shorter than 200 bp, had a low quality score (≤20), contained ambiguous bases or did not exactly match primer sequences and barcode tags. Qualified reads were separated using the sample-specific barcode sequences and trimmed with Illumina Analysis Pipeline Version 2.6. Then, the dataset was analyzed using QIIME. The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97% ([Edgar, 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B16)) to generate rarefaction curves and to calculate the richness and diversity indices. The Ribosomal Database Project (RDP) Classifier tool was used to classify all sequences into different taxonomic groups ([Cole et al., 2009](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B14)). To examine the similarity between different samples, clustering analyses and PCA were used based on the OTU information from each sample using R ([Wang et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B46)). The evolution distances between microbial communities from each sample were calculated using the tayc coefficient and represented as an Unweighted Pair Group Method with Arithmetic Mean (UPGMA) clustering tree describing the dissimilarity (1-similarity) between multiple samples ([Jiang et al., 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B26)). A Newick-formatted tree file was generated through this analysis. To compare the membership and structure of communities in different samples, heat maps were generated with the top 20 OTUs using Mothur ([Jami et al., 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B25)). ### SCFA, Lactose, Galactose and Lactic Acid Quantity The cecal contents were simply sampled in sterile tubes. Samples were kept frozen at −80°C until analysis. The samples were removed from the freezer, and 1,200 μL of water was added to each thawed sample. The samples were vortexed for 1 min until the material was homogenized. The SCFA content was determined by gas chromatography. Chromatographic analysis was carried out using an Agilent GC system with a flame ionization detector (FID) (Shimadzu Corp, Kyoto, Japan). Fused silica capillary columns 30 m × 0.25 mm coated with 0.25 μm film thickness were used. Nitrogen was used as the carrier gas. The oven temperature was 250°C, and the FID and injection port were set to 300 and 250°C, respectively. The injected sample volume was 1 μL, and the run time for each analysis was 32 min. The chromatograms and data integration were carried out using a Shimadzu C-R5A Chromatopac. The method was performed according to reference ([David et al., 2014](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B15)). Lactose, galactose and lactic acid were detected by corresponding assay kits (ELAC-100, EGAL-100 and ECLC-100, respectively, Bioassay Systems, Hayward, CA, United States) according to the instructions. An aliquot of 50 mg of cecal and proximal colon content samples was dissolved in deionized water, vortexed for 20 s and centrifuged at 12,000 × g for 10 min at 4°C. The supernatant was eluted from HLB cartridges and evaporated to dryness under a nitrogen stream. Then, 50 μl of deionized water was added to the tube and redissolved. ### Ussing Chamber Experiments The distal colon was cut longitudinally along the mesenteric border. The serosa, muscularis and submucosa layers were stripped away with fine forceps to prepare a mucosa sample. Stripped mucosa was mounted in a modified Ussing Chamber in a tissue holder (Easy Mount Chamber; Physiologic Instruments, San Diego, CA, United States) with an aperture surface area of 0.3 cm2. Each sample was bathed bilaterally in Krebs-Henseleit solution (KHS). A short-circuit current was measured in vitro in Ussing chambers. Transepithelial PD was then clamped at 0 mV, and the short-circuit current (ISC) was recorded with a VCCMC6 voltage-current clamp amplifier (Physiologic Instruments, San Diego, CA, United States). Transepithelial resistance (TR) (Ω∗cm2) was measured by altering the membrane potential in a stepwise fashion (0.1 mV) and calculated from the ohmic relationship. ### Solutions and Chemicals Krebs-Henseleit solution (KHS) (mmol/L): NaCl, 117; KCl, 4.7; MgCl2, 1.2; KH2PO4, 1.2; NaHCO3, 24.8; CaCl2, 2.5; and glucose, 11.1. The solution was bubbled with 95% O2 and 5% CO2 to maintain a pH value of 7.4. Na\+ free: NMDGCl 117; KCl 4.7; MgCl2.6H2O 1.2; KH2PO3 1.2; choline HCO3 25; CaCl2.2H2O 2.56; GS 11.1. The indomethacin, tetrodotoxin (TTX), DPC, amiloride, and forskolin, were purchased from Sigma (St. Louis, MO, United States). Stock solutions of all the above chemicals were dissolved in DMSO. The final DMSO concentration never exceeded 0.1% (v/v). Preliminary experiments indicated that the vehicle did not alter any baseline electrophysiological parameters. ### Western Blotting Tissue samples were collected from the colon mucosa of the control and high-lactose diets. Tissues were homogenized and sonicated in cold lysis buffer with protein inhibitiors and phosphatase inhibitors (Beyotime Biotechnology, Beijing). After 30 min standing in 4°C, the samples were then centrifuged at 12,000 × g for 30 min at 4°C. The pellets were discarded, and the supernatant was used for blotting. The proteins (50 μg) were separated via 8 or 10% SDS/PAGE. The blot was washed with Tris-buffered saline containing Tween-20 (TBST) and incubated overnight at 4°C with polyclonal primary antibodies against MCT1, sMCT1, NKCC1, and CFTR ([Supplementary Table S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS1)) and the rabbit polyclonal anti-actin antibody ([Supplementary Table S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS1)). After washing with TBST, the membranes were incubated with secondary antibodies ([Supplementary Table S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS1)). ### Immunostaining The specimens were fixed with 4% paraformaldehyde for 10 min at 25°C, rinsed three times, and incubated with blocking serum for 1 h and anti-MCT, anti-sMCT1, anti-NHE3, anti-NKCC1 and anti-CFTR antibodies overnight at 4°C. After washing with PBS, the specimens were incubated with secondary antibodies. All antibodies in the experiments were shown in the [Supplementary Material](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#FS1) ([Supplementary Table S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS1)). Images were obtained using a fluorescence microscope (Leica DM2500, Germany) with 20× or 40× dry lens. ### Statistical Analyses All data are presented as the mean ± SEM. Differences between three groups were evaluated using ANOVA with Prism software (version 9.1, SAS Institute, Inc.), and those between two groups were assessed using the t\-test. The Wilcoxon t\-test was used to compare microbial communities between two groups. Principal component analysis (PCA) plots of bacterial populations were created using Metaboanalyst 3.0. LEfSe analysis of the treatment group was performed on the basis of the results of the Wilcoxon tests, and the threshold on the logarithmic linear discriminant analysis (LDA) score was 3. Significance was defined as P \< 0.05. ## Results ### Effect of IHLD-Induced Diarrhea on the Fecal Form, Fecal Fluid Content and Weight After 30% lactose administration for 48 h, we observed that the majority of rats began to produce wet, loose and yellowish stools. On the 7th day and 14th day, we changed to 40 and 50% lactose and found profuse, watery stools visibly containing lots of mucus with or without a structural pellet form ([Table 1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#T1)). Compared to 30% lactose for 3 weeks, the graded increase in the concentration of lactose avoided the adaptation of rats to lactose and exhibited considerably more diarrhea than the same concentration of 30% lactose for 3 weeks. From our data, IHLD-fed rats could induce persistent and chronic diarrhea compared with only 30 or 40% lactose for 3 weeks, which can avoid adaptation to lactose in rats ([Table 1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#T1)). In the first week, the majority of diarrheic rats (80 and 90%) showed severe diarrhea with profuse, watery stools containing mucus after 30 and 40% lactose diet. In the 3rd week, the fecal characteristics of most rats in the 30 or 40% lactose group showed loose and soft stool pellets, suggesting that diarrhea began to improve. 20% of rats in the IHLD group produced profuse, loose, wet and mucoid stools, and 40% of rats in the IHLD group produced many loose, yellowish, wet stools with or without the structural form of pellets. TABLE 1 \| \| \| \| \| \| \| \|---\|---\|---\|---\|---\|---\| \| Diets \| Form of stool after 48 h to 21st day \| \| \| \| \| \| \| Watery diarrhea + mucous (incontinence or profuse) \| Loose stools + mucous (non-structural stool) \| Loose stool with structural form of pellet \| Soft formed pellets \| Hardened normal pellets \| \| Standard chow diet \| – \| – \| – \| \++ \| \++++ \| \| 30% lactose diet 1st w \| \+++ \| \++ \| \+ \| \+ \| – \| \| 40% lactose diet 1st w \| \++++ \| \++++ \| – \| – \| – \| \| IHLD 1st w \| \+++ \| \++ \| \+ \| \+ \| – \| \| 30% lactose diet 2nd w \| – \| \+ \| \+ \| \+ \| – \| \| 40% lactose diet 2nd w \| \++ \| \++ \| \++ \| – \| – \| \| IHLD 2rd w \| \+ \| \++ \| \+ \| \+ \| – \| \| 30% lactose diet 3rd w \| \+ \| – \| \++ \| \++ \| \+ \| \| 40% lactose diet \| – \| \+ \| \++ \| \+ \| – \| \| 3rd w IHLD 3rd w \| \+ \| \+ \| \++ \| \+ \| – \| Comparison of the severity of diarrhea after single high lactose (30 or 40%) or incremental high lactose diet (30%/40%/50%) feeding for 3 weeks. IHLD: incremental high-lactose diet 1st w: the first week, 2nd w: second week, 3rd w: third week. Qualitative assessment score or classification: – condition not observed, + is the observed once/day; ++ is the observed twice/day. +++ is the observed 3–4 times/day, ++++ is the abundantly observed and +++++ is the almost exclusively observed. The IHLD caused a significant increase in fecal fluid content, as fluid content constituted 79% of stool mass compared with 16% in pellets produced by rats fed the standard diet ([Figure 2A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2); P \< 0.001). Furthermore, IHLD significantly decreased the fecal pH value compared with that of control rats ([Figure 2B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2), P \< 0.001). In addition, an IHLD significantly decreased weight ([Figure 2C](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2)), similar to previous studies ([Liuzzi and Hevia, 1998](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B34); [Boakye et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B8)). The everyday average food consumption and water intake were mildly decreased compared to those of the control group ([Figures 2D,E](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2)). The average urine volume were almost same among the four groups ([Figure 2F](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2)). FIGURE 2 ![FIGURE 2](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g002.webp) Summary data on the characteristics of animals after 30 and 40% lactose and IHLD (30%/40%/50%) lactose diet feeding for 21 days. (A) The three kinds of HLD models caused dramatic increases of 3-fold, 4.2-fold, and 4-fold of the fecal fluid content, respectively. (B) Fecal pH significantly decreased after three kinds of HLD feeding. (C) Three kinds of HLD models caused significant weight loss compared with the standard chow diet (control, P \< 0.001). (D) IHLD (30%/40%/50%) reduced the average food consumption, but 30 and 40% lactose diet food consumption did not significantly alter it. (E) Water intake was decreased after IHLD, but there were no significant differences between IHLD and control. (F) IHLD did not affect average urine compared with control rats. The numbers under the bar graph indicate the rat number. \\P \< 0.01, \\\*P \< 0.001. ### Microbial Dysbiosis After Incremental High-Lactose Diet Incremental high-lactose diet induced significant alterations in the composition of the luminal microbiota of the cecum by 16S rRNA-Amplicon sequencing. A total of 14 samples from the two groups were analyzed by high-throughput pyrosequencing, which generated 1,133,201 clean tags. After IHLD, the Shannon and Chao 1 indexes revealed that the diversity and richness of the microbial communities were significantly lower than those in the control group ([Figure 3A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F3)). Briefly, the results of PCA (Principal component analysis) showed that the composition of the luminal microbiota of IHLD formed a totally different cluster in the ordination plot, suggesting that IHLD caused major changes in the gut microbiome profiles ([Figure 3B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F3)). FIGURE 3 ![FIGURE 3](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g003.webp) The diversity, richness, and microbial composition in the IHLD group differ from those of the control. (A) OTU richness and diversity indices. (B) Principal component analysis of cecal microbiota on the OTU level. Univariate analysis (LDA effect size) was performed to identify the key phyla and genera that exhibited large alterations in microbial composition after IHLD ([Figure 4A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4)). At the phylum level, the abundance of Bacteroidetes (16.54% versus 0.029%) and Verrucomicrobia (1.01% versus 0.0036%) significantly decreased, whereas that of Proteobacteria significantly increased after IHLD (0.58% versus 6.28%) ([Figure 4B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4) and [Supplementary Table S2](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS2)). At the genus level, the abundance of 139 genera showed significant differences between the two groups. The IHLD group showed a marked increase compared to the control group in the relative abundances of Bifidobacterium (0.004% versus 1.12%), Escherichia-Shigella (0.02% versus 5.7%), Megamonas (0.23% versus 20.33%), and Lactobacillus (21.85% versus 70.85%) ([Figure 4B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4) and [Supplementary Table S2](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS2)). In contrast, the concentrations of 59 genera were decreased to zero in the IHLD group, as shown in the [Supplementary Table S2](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS2), including SCFA-producing bacteria such as Ruminococcaceae UCG-013 ([Figure 4C](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4)), Lachnospiraceae UCG-001 and Lachnospiraceae FCS020 group, also including lactose-fermenting Roseburia species increased by administration of a highly purified short-chain galactooligosaccharide (GOS) ([Azcarate-Peril et al., 2017](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B3)). FIGURE 4 ![FIGURE 4](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g004.webp) Changes in the composition of luminal microbiota at the phylum and genus levels between the control and IHLD groups. LEfSe analysis of the differences between two groups at the phylum and genus levels. (A) Heatmap of the relative abundances of predominant phyla (B) and genera \[top 20, (C)\]. The heatmap plot depicts the relative percentage of each bacteria depicted by color intensity with the legend indicated at the bottom of the figure. Correlation analyses were performed to identify the relationships between microbial genera and lactose fermentation products including lactose, galactose, lactate and SCFAs. The results showed the relative abundances of four genera, including Lactobacillus, Bifidobacterium, Megamonas and Escherichia Shigella, showing a strong relationship with lactose, galactose and lactate ([Figure 5](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F5)). Among them, the relative abundance of lactobacilli, as the best-known lactic acid-producing bacteria, was 3.3-fold higher in IHLD than in the control. Another 16 genera, especially Allobaculum, Akkermansia, Lactobacillus, Bifidobacterium, and Bacteroides, with very low relative abundances showed a close association with the concentration of SCFAs. FIGURE 5 ![FIGURE 5](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g005.webp) Constrained correspondence analysis revealing the correlations between the relative abundance of the microbial genus and the concentrations of lactose and lactose fermentation products. ### SCFA, Lactose, Galactose and Lactic Acid Quantification in the Cecal Luminal Contents The SCFA concentration is high in the cecum and proximal colon since SCFAs are produced by microbial fermentation in the cecum ([Tan et al., 2014](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B41); [Kuwahara et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B31)). Therefore, we investigated the concentration of SCFAs in the cecum. Lactose, galactose, lactic acid and SCFAs were quantified in cecal contents in the control and model groups. Interestingly, a significant decrease in the concentration of SCFAs was observed in the intestinal contents in the IHLD group in contrast to the control group. Acetate, propionate and butyrate were 140% lower in the cecum in the model group than in the control group, as presented in [Figures 6A,B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F6), suggesting that SCFA production was lower in the colon. In contrast, lactose, galactose and lactic acid concentrations were 10-, 6-, and 15-fold higher in the IHLD group, respectively than in the control group ([Figure 6C](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F6)). The results suggested that the high concentrations of lactose, lactic acid and galactose in the colon lumen but not SCFAs led to hyperosmosis in the colon, which would be the major reason for diarrhea. FIGURE 6 ![FIGURE 6](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g006.webp) Total amounts of short-chain fatty acids (SCFAs) and lactose, galactose and lactic acid in the cecum luminal contents. (A) Chromatogram of SCFAs, including acetate, propionate, butyrate and 2-ethylbutyric acid (internal standard). (B) SCFAs in the cecum were significantly decreased in IHLD compared to control (\\P \< 0.01, \\\*P \< 0.001). (C) The concentrations of lactose, galactose and lactic acid were significantly increased in the IHLD group compared to the control group. The numbers under the bar graph indicate the rat number. ### Expression and Location of MCT and sMCT1 in the Colon of the IHLD Group and Control Group MCT1 is an H\+\-coupled transporter expressed in the apical membrane and basolateral membrane of the colonic epithelium ([Ritzhaupt et al., 1998](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B36); [Kirat et al., 2009](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B29)), mediating SCFA influx from the lumen and SCFA efflux into the blood ([Iwanaga et al., 2006](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B24)). The western blot results showed that the expression level of MCT1 protein in the colon of the IHLD group was lower by 65% than that in the control group ([Figures 7A,B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)). Moreover, the number and intensity of MCT1 immunopositive cells were greatly decreased in lactose-fed rats ([Figures 7E,F](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)) compared with control animals ([Figures 7C,D](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)), confirming the western blot results. FIGURE 7 ![FIGURE 7](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g007.webp) MCT1 and sMCT1 expression and location after IHLD. Western blot analysis of total MCT1 and sMCT1 in the colon of the control and IHLD models. Images are representative immunoblots of MCT1, sMCT1, and β-actin from five animals in each group (A); densitometric analysis of MCT1 and sMCT1 abundance in colon between control and IHLD model group (\\P \< 0.01) (B). Immunofluorescence staining of MCT1 and sMCT1 in colonic sections of the control (C,D,G) and IHLD model (E,F,H). Panels (D,F) are higher magnification images of the white rectangles in panels (C,E), respectively. The immunoblots are representative of the results obtained from five animals in the model group. Scale bar = 50 μm. sMCT1 is a Na\+\-coupled transporter expressed solely on the apical membrane of the colonic epithelium that mediates SCFA influx from the lumen ([Ritzhaupt et al., 1998](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B36); [Kuwahara et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B31)). The western blot results showed that the expression level of sMCT1 did not change in IHLD rats compared to the control rats, as shown in [Figure 7A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7), consistent with the immunofluorescence results ([Figures 7G,H](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)). ### Involvement of Na\+ Absorption and Anion Secretion in the Colon of the IHLD-Induced Diarrhea Group In order to investigate the basal and stimulated ion transport in the colonic epithelium of the IHLD group, a Ussing Chamber experiment was performed. In short circuit current recording, the basal current represents a summation of all ionic currents across the epithelium ([Xue et al., 2007](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B49); [Clarke, 2009](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B13)). The basal ISC was lower in the IHLD-model group (IHLD: 48 ± 5.15 μA/cm2 versus control: 108 ± 37.23 μA/cm2, n = 10, [Figure 7A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)). In apical Na\+\-free KHS, the basal ISC without apical Na\+ absorption in the colonic mucosa of the control group was similar to that of the IHLD group (IHDL: −86.42 ± 7.8 μA/cm2 versus control: −89.69 ± 11.41 μA/cm2, n = 11). However, the Δbasal ISC (subtract the basal ISC in apical Na\+\-free KHS from the basal ISC in normal KHS) in the colonic mucosa of the IHLD group was significantly decreased (IHLD 134.4 ± 2.65 μA/cm2 versus control: 197.8 ± 25.82 μA/cm2, n = 10, [Figure 7A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)), suggesting that Na\+ absorption was lower in the IHLD group. After apical treatment with the ENaC inhibitor amiloride, a similar inhibition of basal ISC was observed in the control and IHLD groups, excluding the ENaC involved in the ion transport of the IHLD group (IHLD: −6.54 ± 1.73 μA/cm2 versus control: −6.98 ± 2.22 μA/cm2, [Supplementary Figure S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#FS1)). As [Figure 8](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F8) shown, the results of western blotting and immunostaining showed that the level of total protein expression and phosphorylation of NHE3 protein-mediated Na\+ absorption in the colon were downregulated by 37 and 67% respectively, in the model group compared with the control group ([Figures 8B–G](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F8)), which was responsible for the low Na\+ absorption. FIGURE 8 ![FIGURE 8](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g008.webp) Decreased NHE3 expression and phosphorylation levels and Na\+ absorption involved in lactose-induced chronic diarrhea. Baseline ISC current and delta basal ISC in colonic epithelium between the control and IHLD groups (\*P \< 0.05, \\P \< 0.01) (A). Western blot analysis of total NHE3 and phosphorylated NHE3 in the colon of the control and IHLD models. (B,C) Images are representative immunoblots of NHE3 and phosphorylated NHE3 from five animals in each group (B). densitometric analysis of NHE3 and relative NHE3 phosphorylation (pNHE3/NHE3) in colon between control and IHLD model group (\*P \< 0.05) (C) Immunofluorescence staining of NHE3 and phosphorylated NHE3 in the colon between the control (D,F) and model (E,G) groups. The right inset is zoomed image of white rectangle (D,E). Scale bar = 50 μm. Furthermore, the cAMP elevator forskolin (1 μM, basolateral)-induced ISC increase in the colon of the IHLD group was lower than that in the control group (IHLD: 128.3 ± 15.3 μA/cm2 versus control: 201.4 ± 28.31 μA/cm2, [Figure 9A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F9)). The inhibition of basal ISC induced by apical treatment with a known CFTR inhibitor DPC (diphenylamine-2, 2′-dicarboxylic acid), was significantly higher in the control group than in the IHLD group, suggesting that CFTR-mediated Cl– secretion under basal conditions was decreased in the IHLD group compared with the control group (IHLD: −1.12 ± 1.74 μA/cm2 versus control: −8.10 ± 2.14 μA/cm2, [Supplementary Figure S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#FS1)). The western blot and immunostaining results showed that the protein expression levels of NKCC1 and CFTR in the colonic mucosa were decrease by 50 and 24%,respectively, than those in the control group, contributing to the lower basal and stimulated ion secretion in the model group ([Figures 9B–G](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F9)). FIGURE 9 ![FIGURE 9](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g009.webp) Mucosal secretory responses and expression of CFTR and NKCC1 in rats after IHLD/SD feeding for 21 days. Forskolin-stimulated ISC(A) in the colonic epithelium (\*P \< 0.05). The numbers under the bar graph are the samples number from four different rats. Western blot analysis of total NKCC1 and CFTR in the colon of the control and IHLD models. (\*P \< 0.05). (B,C) Images are representative immunoblots of CFTR and NKCC1 from five animals in each group. Immunofluorescence staining of NKCC1 (D,E) and CFTR (F,G) in the colon between the control (D,F) and model (E,G) groups. Scale bar = 50 μm. ### Discussion Lactose intolerance (LI) appears to be mainly associated with unabsorbed lactose in the small intestine passing into the colon and being metabolized by colonic bacteria to organic acids, including lactic acid and short-chain fatty acids. The organic acids escaping absorption by the colon remain in the colonic lumen and lead to osmotic diarrhea. Previous studies have shown that lactose-induced diarrhea results, in large part, from the combination of net fluid secretion by the stomach and small intestine and interference with net fluid absorption in the colon ([Christopher and Bayless, 1971](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B12); [Hammer et al., 1989](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B21)). In our study, we established a chronic diarrhea model using lactose with a gradual increase in concentration for 3 weeks to investigate the mechanism of high lactose-induced diarrhea on organic acid production and ion transport of the colonic epithelium and NHE3, CFTR and NKCC1 expression combined with epithelial locations, which are associated with Na\+ absorption and Cl– secretion. The concentrations of lactose, galactose and lactic acid in the cecum in the IHLD model group were higher than those in the control group, but the concentration of SCFAs was lower, suggesting that the major reason for hyperosmosis is due to high concentrations of lactose, galactose and lactic acid in the intestinal lumen, which could cause osmotic diarrhea. Furthermore, the concentration of lactic acid in the cecum content was much higher than that in the control group, which was responsible for the low pH in the feces. Adult rats, as mammals, have intestinal lactase activity that decreases quickly upon weaning, and research has shown that although residual lactase activity is present in adult rats, a high-lactose diet is poorly digested by adult rats ([Alexandre et al., 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B2); [van de Heijning et al., 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B43)). The increase in galactose in the cecum contents after chronic feeding with high lactose might be due to microbiota fermentation. As expected, our results showed that significant differences were observed in the composition of cecum microbiota via high-throughput MiSeq sequencing after IHLD. A previous study ([Francavilla et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B18)) investigated the influence of lactose on the composition of the gut microbiota and the SCFAs of infants with cow’s milk allergy. Similar to our findings, lactose intake can induce an increase in Bifidobacteria and Lactobacilli and a decrease in the numbers of Bacteroides, Prevotella and Clostridia. In addition, we also found that the increased abundances of another two genera, Escherichia-shigella and Megamonas, were positively related to the concentrations of lactose, galactose and lactic acid and might be responsible for the IHLD-induced diarrhea. They also measured SCFA levels and found that the concentration of SCFA increased after addition of lactose, which was the opposite result of our study because of the differences between from infants and adults. In addition, we found the loss of important SCFA-producing microbes, such as lachnospiraceae NK4A136 group and ruminococcaceae UCG-005, after IHLD, which might lead to the lower concentration of luminal SCFAs, consistent with a recent study on a high-sugar diet ([Laffin et al., 2019](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B32)). Another recent study ([Kamphuis et al., 2019](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B28)) showed that oral gavage with lactose at a modest dose of 5 mg/day for 3 weeks did not induce alterations in the fecal microbiota of mice, which was different from our study because of the low dose of lactose without significant malabsorption. In our results, we found that the concentrations of SCFAs in the cecal contents of the model group was significantly decreased compared with that of the control group, which was different from a previous study that showed that an increase in SCFAs resulted in acute ingestion of lactose in vivo and in vitro ([He et al., 2006](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B22); [Windey et al., 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B48)). Few studies have focused on the effect of chronic lactose intervention on SCFAs, and a recent study ([Zhai et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B51)) found no significant difference in the SCFA concentration of feces after 3 weeks of lactulose intervention in mice, suggesting a different mechanism between acute and chronic ingestion. In the colon, SCFAs are absorbed by MCT1 and sMCT1 in the colon epithelium. Our results showed that an unaltered expression level and differential distribution of sMCT1 were observed between the control group and IHLD group. However, MCT1 expression was significantly decreased, showing that its low expression level might be caused by lower SCFAs in the lumen, which is also reported to be regulated by butyrate ([Borthakur et al., 2008](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B10), [2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B9)). Currently, there is growing evidence indicating that SCFAs are a product of bacterial fermentation involved in the regulation of ion transport ([Yajima et al., 2011](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B50); [Tan et al., 2014](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B41); [Kuwahara et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B31)). Previous studies demonstrated that luminal addition of propionate stimulates chloride secretion, which function as a lubricant for the movement of luminal contents in the colon ([Yajima et al., 2011](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B50)). It has been reported that NHE3 mediates Na\+ absorption in the colon, and our data showed that its expression and phosphorylation level were significantly decreased in the model group, confirming a decrease in Na\+ absorption. The results of the Ussing Chamber demonstrated that when apical Na\+ was removed, the delta basal ISC in the IHLD group was significantly decreased, suggesting that Na\+ absorption was involved in the basal current. It is generally accepted that the absorption of Na\+ and Cl– in the colon is mutually interdependent, electrically neutral by largely apical Na/H exchange and Cl/HCO3 exchange processes, primarily involving the Na/H exchanger NHE3 and the Cl/HCO3 exchanger ([Walker et al., 2008](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B45)). The evidence from the present study showed that Na\+ absorption and NHE3 protein expression and phosphorylation were decreased in IHLD rats compared with control rats, but the RNA level of NHE3 and the change in the expression of the Cl/HCO3 exchanger involving Cl– absorption still need to be investigated. To the best of our knowledge, no previous report has found that NHE3 is involved in lactose-induced diarrhea and might be a novel target for the attenuation of lactose-induced diarrhea. In this study, we used the chronic diarrhea model induced by giving high lactose for 3 weeks, which could employ a compensatory mechanism to adapt to the diarrhea situation. A previous study showed that rats adapted to a lactose diet and that the size of the cecum returned to normal, but its mechanisms are not clear ([Lawrence et al., 1956](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B33); [Szilagyi, 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B40)). Our results showed that basal current and FSK-induced Cl– secretion in the model group were lower than those in the control group, which can result in lower luminal anionic secretion and associated luminal transport of water. Furthermore, the NKCC1 and CFTR expression levels in the colon mucosa in the model group decreased compared with those in the control group, resulting in a decrease in basal and FSK-induced ISC. We considered it to have resulted from the compensatory mechanism. In the duodenum, luminal SCFAs induced HCO−3 3 \- secretion ([Akiba et al., 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B1)). Our study showed that lower luminal SCFAs decrease Cl– secretion, but the mechanism should be investigated further. Taken together, IHLD feeding to rats caused a persistent state of diarrhea, and the cecum tripled in size. The concentrations of lactose, galactose and lactic acid were markedly increased in the cecal luminal contents, contributing to lactose intolerance-induced high osmosis diarrhea. Meanwhile, the lumen SCFA concentration of the cecal contents was significantly decreased. This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and an increase in the relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. In addition, the microbiota diversity in the colon was found to be lower in the cecum of IHLD rats compared with control rats. Concomitantly, the expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels in the colonic mucosa of the IHLD group contributed to the Na\+ absorption and accumulation decrease in the lumen, and the stimulated Cl– secretion decrease would be a compensatory effect for water and electrolyte loss during the diarrhea process ([Figure 10](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F10)). The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbita and Na\+ absorption. FIGURE 10 ![FIGURE 10](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g010.webp) Schematic diagram of lactose-induced chronic diarrhea. Amounts of lactose, galactose and lactic acid remaining in the cecum resulted in microbiota dysbiosis, which was related to low lumen SCFAs. Low NHE3 expression and phosphorylation levels in the colonic mucosa of the IHLD group contributed to a decrease in Na\+ absorption and accumulation in the lumen, and a decrease in stimulated Cl– secretion would compensate for water and electrolyte loss during the diarrhea process. ## Statements ### Data availability statement The original contributions presented in the study are publicly available. This data can be found here: <https://www.ncbi.nlm.nih.gov/bioproject/PRJNA611011>. ### Ethics statement The animal study was reviewed and approved by the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). ### Author contributions HX, FW, and XT conceived the study. HX designed the experiment, wrote the manuscript, and performed the western blotting and immunostaining. MZ and JM made the animal models and performed the Ussing Chamber experiments. HX quantified SCFAs. HX and TC analyzed the data. FW and XT supervised the research. All authors contributed to the article and approved the submitted version. ### Funding This work was supported by the National Natural Science Foundation of China (Grant No. 81973838) and National Key Research and Development Project (Grant No. 2016YFC1302203). ### Acknowledgments The authors thank Prof. Wang Jiannong and Dr. Sun Caixia for their help for technical support on GC analyses for measuring SCFA levels. ### Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. ### Supplementary material The Supplementary Material for this article can be found online at: [https://www.frontiersin.org/articles/10.3389/fphys.2020.00877/full\#supplementary-material](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#supplementary-material) FIGURE S1 Comparison of effect of DPC or amiloride on the basal ISC current between control and IHLD group. Values are means ± SEM; P \< 0.05. TABLE S1 Antibodies for western and immunofluorescence. TABLE S2 Information of statistical test analysis of phylum and genus level between control and IHLD group. ## References - 1 AkibaY.InoueT.KajiI.NarimatsuK.IwamotoK.et al (2015). Short-chain fatty acid sensing in rat duodenum.J. Physiol.593585–599. 10.1113/jphysiol.2014.280792 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/25433076) - [CrossRef](https://doi.org/10.1113/jphysiol.2014.280792) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=Y..%2BAkiba&author=T..%2BInoue&author=I..%2BKaji&author=K..%2BNarimatsu&author=K..%2BIwamoto&publication_year=2015&title=Short-chain%2Bfatty%2Bacid%2Bsensing%2Bin%2Brat%2Bduodenum.&journal=J.+Physiol.&volume=593&pages=585-599) - 2 AlexandreV.EvenP. C.LarueA. C.BlouinJ. M.BlachierF.BenamouzigR.et al (2013). Lactose malabsorption and colonic fermentations alter host metabolism in rats.Br. J. Nutr.110625–631. 10.1017/S0007114512005557 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23321004) - [CrossRef](https://doi.org/10.1017/S0007114512005557) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=V..%2BAlexandre&author=P.%2BC..%2BEven&author=A.%2BC..%2BLarue&author=J.%2BM..%2BBlouin&author=F..%2BBlachier&author=R..%2BBenamouzig&publication_year=2013&title=Lactose%2Bmalabsorption%2Band%2Bcolonic%2Bfermentations%2Balter%2Bhost%2Bmetabolism%2Bin%2Brats.&journal=Br.+J.+Nutr.&volume=110&pages=625-631) - 3 Azcarate-PerilM. A.RitterA. J.SavaianoD.Monteagudo-MeraA.AndersonC.MagnessS. T. (2017). Impact of the short-chain galactooligosaccharides on the gut microbiome of lactose-intolerant individuals.Proc. Natl. Acad. Sci. U.S.A.114E367–E375. 10.1073/pnas.1606722113 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/28049818) - [CrossRef](https://doi.org/10.1073/pnas.1606722113) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=M.%2BA..%2BAzcarate-Peril&author=A.%2BJ..%2BRitter&author=D..%2BSavaiano&author=A..%2BMonteagudo-Mera&author=C..%2BAnderson&author=S.%2BT..%2BMagness&publication_year=2017&title=Impact%2Bof%2Bthe%2Bshort-chain%2Bgalactooligosaccharides%2Bon%2Bthe%2Bgut%2Bmicrobiome%2Bof%2Blactose-intolerant%2Bindividuals.&journal=Proc.+Natl.+Acad.+Sci.+U.S.A.&volume=114&pages=E367-E375) - 4 BaylessT. M.BrownE.PaigeD. M. (2017). Lactase Non-persistence and Lactose Intolerance.Curr. Gastroenterol. Rep19:23. 10.1007/s11894-017-0558-9 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/28421381) - [CrossRef](https://doi.org/10.1007/s11894-017-0558-9) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T.%2BM..%2BBayless&author=E..%2BBrown&author=D.%2BM..%2BPaige&publication_year=2017&title=Lactase%2BNon-persistence%2Band%2BLactose%2BIntolerance.&journal=Curr.+Gastroenterol.+Rep&volume=19) - 5 BinderH. J. (2010). Role of Colonic Short-chain fatty acid transport in diarrhea.*Annu. Rev. Physiol.72297–313. 10.1146/annurev-physiol-021909-135817 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/20148677) - [CrossRef](https://doi.org/10.1146/annurev-physiol-021909-135817) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BJ..%2BBinder&publication_year=2010&title=Role%2Bof%2BColonic%2BShort-chain%2Bfatty%2Bacid%2Btransport%2Bin%2Bdiarrhea.&journal=Annu.+Rev.+Physiol.&volume=72&pages=297-313) - 6 BinderH. J.FosterE. S.BudingerM. E.HayslettJ. P. (1987). Mechanism of electroneutral sodium chloride absorption in distal colon of the rat.Gastroenterology93449–455. 10.1016/0016-5085(87)90905-x - [CrossRef](https://doi.org/10.1016/0016-5085\(87\)90905-x) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BJ..%2BBinder&author=E.%2BS..%2BFoster&author=M.%2BE..%2BBudinger&author=J.%2BP..%2BHayslett&publication_year=1987&title=Mechanism%2Bof%2Belectroneutral%2Bsodium%2Bchloride%2Babsorption%2Bin%2Bdistal%2Bcolon%2Bof%2Bthe%2Brat.&journal=Gastroenterology&volume=93&pages=449-455) - 7 BinderH. J.SandleG. I.RajendranV. M. (1991). “Colonic fluid and electrolyte transport in health and disease,” in The Large Intestine: Physiology, Pathophysiology, and Disease, edsPhillipsS. F.PembertonJ. H.ShorterR. G. (New York, NY: Raven Press), 141–168. - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BJ..%2BBinder&author=G.%2BI..%2BSandle&author=V.%2BM..%2BRajendran&publication_year=1991&title=Colonic%2Bfluid%2Band%2Belectrolyte%2Btransport%2Bin%2Bhealth%2Band%2Bdisease&journal=The+Large+Intestine%3A+Physiology%2C+Pathophysiology%2C+and+Disease&pages=141-168) - 8 BoakyeP. A.BrierleyS. M.BalembaO. B. (2012). Garcinia buchananii bark extract is an effective anti-diarrheal remedy for lactose-induced diarrhea.J. Ethnopharmacol.142539–547. 10.1016/j.jep.2012.05.034 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22643232) - [CrossRef](https://doi.org/10.1016/j.jep.2012.05.034) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=P.%2BA..%2BBoakye&author=S.%2BM..%2BBrierley&author=O.%2BB..%2BBalemba&publication_year=2012&title=Garcinia%2Bbuchananii%2Bbark%2Bextract%2Bis%2Ban%2Beffective%2Banti-diarrheal%2Bremedy%2Bfor%2Blactose-induced%2Bdiarrhea.&journal=J.+Ethnopharmacol.&volume=142&pages=539-547) - 9 BorthakurA.PriyamvadaS.KumarA.NatarajanA. A.GillR. K.AlrefaiW. A.et al (2012). A novel nutrient sensing mechanism underlies substrate-induced regulation of monocarboxylate transporter 1.Am. J. Physiol. Gastrointest. Liver. Physiol.303G1126–G1133. 10.1152/ajpgi.00308.2012 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22982338) - [CrossRef](https://doi.org/10.1152/ajpgi.00308.2012) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BBorthakur&author=S..%2BPriyamvada&author=A..%2BKumar&author=A.%2BA..%2BNatarajan&author=R.%2BK..%2BGill&author=W.%2BA..%2BAlrefai&publication_year=2012&title=A%2Bnovel%2Bnutrient%2Bsensing%2Bmechanism%2Bunderlies%2Bsubstrate-induced%2Bregulation%2Bof%2Bmonocarboxylate%2Btransporter%2B1.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=303&pages=G1126-G1133) - 10 BorthakurA.SaksenaS.GillR. K.AlrefaiW. A.RamaswamyK.DudejaP. K. (2008). Regulation of monocarboxylate transporter 1 (MCT1) promoter by butyrate in human intestinal epithelial cells: Involvement of NF-κB pathway.J. Cell. Biochem.1031452–1463. 10.1002/jcb.21532 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/17786924) - [CrossRef](https://doi.org/10.1002/jcb.21532) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BBorthakur&author=S..%2BSaksena&author=R.%2BK..%2BGill&author=W.%2BA..%2BAlrefai&author=K..%2BRamaswamy&author=P.%2BK..%2BDudeja&publication_year=2008&title=Regulation%2Bof%2Bmonocarboxylate%2Btransporter%2B1%2B%28MCT1%29%2Bpromoter%2Bby%2Bbutyrate%2Bin%2Bhuman%2Bintestinal%2Bepithelial%2Bcells%3A%2BInvolvement%2Bof%2BNF-%CE%BAB%2Bpathway.&journal=J.+Cell.+Biochem.&volume=103&pages=1452-1463) - 11 BryceJ.BoschiP. C.ShibuyaK.BlackR. E. (2005). WHO estimates of the causes of death in children.Lancet3651147–1152. 10.1016/S0140-6736(05)71877-8 - [CrossRef](https://doi.org/10.1016/S0140-6736\(05\)71877-8) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J..%2BBryce&author=P.%2BC..%2BBoschi&author=K..%2BShibuya&author=R.%2BE..%2BBlack&publication_year=2005&title=WHO%2Bestimates%2Bof%2Bthe%2Bcauses%2Bof%2Bdeath%2Bin%2Bchildren.&journal=Lancet&volume=365&pages=1147-1152) - 12 ChristopherN. L.BaylessT. M. (1971). Role of the small bowel and colon in lactose-induced diarrhea.Gastroenterology60845–852. 10.1016/s0016-5085(71)80083-5 - [CrossRef](https://doi.org/10.1016/s0016-5085\(71\)80083-5) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=N.%2BL..%2BChristopher&author=T.%2BM..%2BBayless&publication_year=1971&title=Role%2Bof%2Bthe%2Bsmall%2Bbowel%2Band%2Bcolon%2Bin%2Blactose-induced%2Bdiarrhea.&journal=Gastroenterology&volume=60&pages=845-852) - 13 ClarkeL. L. (2009). A guide to Ussing chamber studies of mouse intestine.Am. J. Physiol. Gastrointest. Liver. Physiol.296G1151–G1166. 10.1152/ajpgi.90649.2008 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/19342508) - [CrossRef](https://doi.org/10.1152/ajpgi.90649.2008) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=L.%2BL..%2BClarke&publication_year=2009&title=A%2Bguide%2Bto%2BUssing%2Bchamber%2Bstudies%2Bof%2Bmouse%2Bintestine.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=296&pages=G1151-G1166) - 14 ColeJ. R.WangQ. E.CardenasJ.FishB.ChaiR. J.FarrisA. S.et al (2009). The ribosomal database project: improved alignments and new tools for rRNA analysis.Nucleic Acids Res.37D141–D145. 10.1093/nar/gkn879 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/19004872) - [CrossRef](https://doi.org/10.1093/nar/gkn879) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J.%2BR..%2BCole&author=Q.%2BE..%2BWang&author=J..%2BCardenas&author=B..%2BFish&author=R.%2BJ..%2BChai&author=A.%2BS..%2BFarris&publication_year=2009&title=The%2Bribosomal%2Bdatabase%2Bproject%3A%2Bimproved%2Balignments%2Band%2Bnew%2Btools%2Bfor%2BrRNA%2Banalysis.&journal=Nucleic+Acids+Res.&volume=37&pages=D141-D145) - 15 DavidL. A.MauriceC. F.ButtonJ. E.WolfeB. E.et al (2014). Diet rapidly and reproducibly alters the human gut microbiome.Nature505559–563. 10.1038/nature12820 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/24336217) - [CrossRef](https://doi.org/10.1038/nature12820) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=L.%2BA..%2BDavid&author=C.%2BF..%2BMaurice&author=J.%2BE..%2BButton&author=B.%2BE..%2BWolfe&publication_year=2014&title=Diet%2Brapidly%2Band%2Breproducibly%2Balters%2Bthe%2Bhuman%2Bgut%2Bmicrobiome.&journal=Nature&volume=505&pages=559-563) - 16 EdgarR. C. (2013). UPARSE: Highly accurate OTU sequences from microbial amplicon reads.Nat Methods10996–998. 10.1038/nmeth.2604 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23955772) - [CrossRef](https://doi.org/10.1038/nmeth.2604) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=R.%2BC..%2BEdgar&publication_year=2013&title=UPARSE%3A%2BHighly%2Baccurate%2BOTU%2Bsequences%2Bfrom%2Bmicrobial%2Bamplicon%2Breads.&journal=Nat+Methods&volume=10&pages=996-998) - 17 FassioF.FacioniM. S.GuagniniF. (2018). Lactose maldigestion, malabsorption, and intolerance: a comprehensive review with focus on current management and future perspectives.Nutrients10:1599. 10.3390/nu10111599 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/30388735) - [CrossRef](https://doi.org/10.3390/nu10111599) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=F..%2BFassio&author=M.%2BS..%2BFacioni&author=F..%2BGuagnini&publication_year=2018&title=Lactose%2Bmaldigestion%2C%2Bmalabsorption%2C%2Band%2Bintolerance%3A%2Ba%2Bcomprehensive%2Breview%2Bwith%2Bfocus%2Bon%2Bcurrent%2Bmanagement%2Band%2Bfuture%2Bperspectives.&journal=Nutrients&volume=10) - 18 FrancavillaR.CalassoM.CalaceL.SiragusaS.NdagijimanaM.VernocchiP.et al (2012). Effect of lactose on gut microbiota and metabolome of infants with cow’s milk allergy.Pediatr. Allergy Immunol.3420–427. 10.1111/j.1399-3038.2012.01286.x - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22435727) - [CrossRef](https://doi.org/10.1111/j.1399-3038.2012.01286.x) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=R..%2BFrancavilla&author=M..%2BCalasso&author=L..%2BCalace&author=S..%2BSiragusa&author=M..%2BNdagijimana&author=P..%2BVernocchi&publication_year=2012&title=Effect%2Bof%2Blactose%2Bon%2Bgut%2Bmicrobiota%2Band%2Bmetabolome%2Bof%2Binfants%2Bwith%2Bcow%E2%80%99s%2Bmilk%2Ballergy.&journal=Pediatr.+Allergy+Immunol.&volume=3&pages=420-427) - 19 GanapathyV.GopalE.MiyauchiS.PrasadP. D. (2005). Biological functions of SLC5A8,candidate tumour suppressor.Biochem. Soc. Trans.33(Pt 1)237–240. 10.1042/BST0330237 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/15667316) - [CrossRef](https://doi.org/10.1042/BST0330237) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=V..%2BGanapathy&author=E..%2BGopal&author=S..%2BMiyauchi&author=P.%2BD..%2BPrasad&publication_year=2005&title=Biological%2Bfunctions%2Bof%2BSLC5A8%2Ccandidate%2Btumour%2Bsuppressor.&journal=Biochem.+Soc.+Trans.&volume=33%28Pt+1%29&pages=237-240) - 20 HammerH. F.HammerJ. (2012). Diarrhea caused by carbohydrate malabsorption.Gastroenterol. Clin. N. Am.41611–627. 10.1016/j.gtc.2012.06.003 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22917167) - [CrossRef](https://doi.org/10.1016/j.gtc.2012.06.003) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BF..%2BHammer&author=J..%2BHammer&publication_year=2012&title=Diarrhea%2Bcaused%2Bby%2Bcarbohydrate%2Bmalabsorption.&journal=Gastroenterol.+Clin.+N.+Am.&volume=41&pages=611-627) - 21 HammerH. F.Santa AnaC. A.SchillerL. R.FordtranJ. S. (1989). Studies of osmotic diarrhea induced in normal subjects by ingestion of polyethylene glycol and lactulose.J. Clin. Invest.841056–1062. 10.1172/JCI114267 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/2794043) - [CrossRef](https://doi.org/10.1172/JCI114267) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BF..%2BHammer&author=C.%2BA..%2BSanta%2BAna&author=L.%2BR..%2BSchiller&author=J.%2BS..%2BFordtran&publication_year=1989&title=Studies%2Bof%2Bosmotic%2Bdiarrhea%2Binduced%2Bin%2Bnormal%2Bsubjects%2Bby%2Bingestion%2Bof%2Bpolyethylene%2Bglycol%2Band%2Blactulose.&journal=J.+Clin.+Invest.&volume=84&pages=1056-1062) - 22 HeT.PriebeM. G.HarmsenH. J.StellaardF.SunX.WellingG. W.et al (2006). Colonic fermentation may play a role in lactose intolerance in humans.J. Nutr.13658–63. 10.1093/jn/136.1.58 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/16365059) - [CrossRef](https://doi.org/10.1093/jn/136.1.58) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T..%2BHe&author=M.%2BG..%2BPriebe&author=H.%2BJ..%2BHarmsen&author=F..%2BStellaard&author=X..%2BSun&author=G.%2BW..%2BWelling&publication_year=2006&title=Colonic%2Bfermentation%2Bmay%2Bplay%2Ba%2Brole%2Bin%2Blactose%2Bintolerance%2Bin%2Bhumans.&journal=J.+Nutr.&volume=136&pages=58-63) - 23 HoqueK. M.ChakrabortyS.SheikhI. A.WoodwardO. M. (2012). New advances in the pathophysiology of intestinal ion transport and barrier function in diarrhea and the impact on therapy.Expert Rev. Anti Infect. Ther.10687–699. 10.1586/eri.12.47 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22734958) - [CrossRef](https://doi.org/10.1586/eri.12.47) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=K.%2BM..%2BHoque&author=S..%2BChakraborty&author=I.%2BA..%2BSheikh&author=O.%2BM..%2BWoodward&publication_year=2012&title=New%2Badvances%2Bin%2Bthe%2Bpathophysiology%2Bof%2Bintestinal%2Bion%2Btransport%2Band%2Bbarrier%2Bfunction%2Bin%2Bdiarrhea%2Band%2Bthe%2Bimpact%2Bon%2Btherapy.&journal=Expert+Rev.+Anti+Infect.+Ther.&volume=10&pages=687-699) - 24 IwanagaT.TakebeK.KatoI.KarakiS.KuwaharaA. (2006). Cellular expression of monocarboxylate transporters (MCT) in the digestive tract of the mouse, rat, and humans, with special reference to slc5a8.Biomed. Res.27243–254. 10.2220/biomedres.27.243 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/17099289) - [CrossRef](https://doi.org/10.2220/biomedres.27.243) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T..%2BIwanaga&author=K..%2BTakebe&author=I..%2BKato&author=S..%2BKaraki&author=A..%2BKuwahara&publication_year=2006&title=Cellular%2Bexpression%2Bof%2Bmonocarboxylate%2Btransporters%2B%28MCT%29%2Bin%2Bthe%2Bdigestive%2Btract%2Bof%2Bthe%2Bmouse%2C%2Brat%2C%2Band%2Bhumans%2C%2Bwith%2Bspecial%2Breference%2Bto%2Bslc5a8.&journal=Biomed.+Res.&volume=27&pages=243-254) - 25 JamiE.IsraelA.KotserA.MizrahiI. (2013). Exploring the bovine rumen bacterial community from birth to adulthood.ISME J.71069–1079. 10.1038/ismej.2013.2 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23426008) - [CrossRef](https://doi.org/10.1038/ismej.2013.2) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=E..%2BJami&author=A..%2BIsrael&author=A..%2BKotser&author=I..%2BMizrahi&publication_year=2013&title=Exploring%2Bthe%2Bbovine%2Brumen%2Bbacterial%2Bcommunity%2Bfrom%2Bbirth%2Bto%2Badulthood.&journal=ISME+J.&volume=7&pages=1069-1079) - 26 JiangX. T.PengX.DengG. H.ShengH. F.WangY.ZhouH. W. (2013). Illumina sequencing of 16S rRNA Tag revealed spatial variations of bacterial communities in a mangrove wetland.Microb. Ecol.6696–104. 10.1007/s00248-013-0238-8 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23649297) - [CrossRef](https://doi.org/10.1007/s00248-013-0238-8) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=X.%2BT..%2BJiang&author=X..%2BPeng&author=G.%2BH..%2BDeng&author=H.%2BF..%2BSheng&author=Y..%2BWang&author=H.%2BW..%2BZhou&publication_year=2013&title=Illumina%2Bsequencing%2Bof%2B16S%2BrRNA%2BTag%2Brevealed%2Bspatial%2Bvariations%2Bof%2Bbacterial%2Bcommunities%2Bin%2Ba%2Bmangrove%2Bwetland.&journal=Microb.+Ecol.&volume=66&pages=96-104) - 27 KajiI.AkibaY.KonnoK.WatanabeM.KimuraS.IwanagaT. (2016). Neural FFA3 activation inversely regulates anion secretion evoked by nicotinic ACh receptor activation in rat.J. Physiol.5943339–3352. 10.1113/JP271441 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/26854275) - [CrossRef](https://doi.org/10.1113/JP271441) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=I..%2BKaji&author=Y..%2BAkiba&author=K..%2BKonno&author=M..%2BWatanabe&author=S..%2BKimura&author=T..%2BIwanaga&publication_year=2016&title=Neural%2BFFA3%2Bactivation%2Binversely%2Bregulates%2Banion%2Bsecretion%2Bevoked%2Bby%2Bnicotinic%2BACh%2Breceptor%2Bactivation%2Bin%2Brat.&journal=J.+Physiol.&volume=594&pages=3339-3352) - 28 KamphuisJ. B. J.GuiardB.LevequeM.OlierM.JouaninI.YvonS.et al (2019). Lactose and fructo-ligosaccharides increase visceral sensitivity in mice via glycation processes, increasing mast cell density in colonic mucosa.Gastroenterology158652–663.e6. 10.1053/j.gastro.2019.10.037652663e6 - [CrossRef](https://doi.org/10.1053/j.gastro.2019.10.037652663e6) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J.%2BB.%2BJ..%2BKamphuis&author=B..%2BGuiard&author=M..%2BLeveque&author=M..%2BOlier&author=I..%2BJouanin&author=S..%2BYvon&publication_year=2019&title=Lactose%2Band%2Bfructo-ligosaccharides%2Bincrease%2Bvisceral%2Bsensitivity%2Bin%2Bmice%2Bvia%2Bglycation%2Bprocesses%2C%2Bincreasing%2Bmast%2Bcell%2Bdensity%2Bin%2Bcolonic%2Bmucosa.&journal=Gastroenterology&volume=158&pages=652-663.e6) - 29 KiratD.KondoK.ShimadaR.KatoS. (2009). Dietary pectin up-regulates monocaboxylate transporter1 in the rat gastrointestinal tract.Exp. Physiol.94422–433. 10.1113/expphysiol.2009.046797 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/19168540) - [CrossRef](https://doi.org/10.1113/expphysiol.2009.046797) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=D..%2BKirat&author=K..%2BKondo&author=R..%2BShimada&author=S..%2BKato&publication_year=2009&title=Dietary%2Bpectin%2Bup-regulates%2Bmonocaboxylate%2Btransporter1%2Bin%2Bthe%2Brat%2Bgastrointestinal%2Btract.&journal=Exp.+Physiol.&volume=94&pages=422-433) - 30 KunzelmannK.MallM. (2002). Electrolyte transport in the mammalian colon: mechanisms and implications for disease.Physiol Rev.82245–289. 10.1152/physrev.00026.2001 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/11773614) - [CrossRef](https://doi.org/10.1152/physrev.00026.2001) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=K..%2BKunzelmann&author=M..%2BMall&publication_year=2002&title=Electrolyte%2Btransport%2Bin%2Bthe%2Bmammalian%2Bcolon%3A%2Bmechanisms%2Band%2Bimplications%2Bfor%2Bdisease.&journal=Physiol+Rev.&volume=82&pages=245-289) - 31 KuwaharaA.KuwaharaY.InuiT.MarunakaY. (2018). Regulation of ion transport in the intestine by free fatty acid receptor 2 and 3: possible involvement of the diffuse chemosensory system.Int. J. Mol. Sci.19:735. 10.3390/ijms19030735 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/29510573) - [CrossRef](https://doi.org/10.3390/ijms19030735) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BKuwahara&author=Y..%2BKuwahara&author=T..%2BInui&author=Y..%2BMarunaka&publication_year=2018&title=Regulation%2Bof%2Bion%2Btransport%2Bin%2Bthe%2Bintestine%2Bby%2Bfree%2Bfatty%2Bacid%2Breceptor%2B2%2Band%2B3%3A%2Bpossible%2Binvolvement%2Bof%2Bthe%2Bdiffuse%2Bchemosensory%2Bsystem.&journal=Int.+J.+Mol.+Sci.&volume=19) - 32 LaffinM.FedorakR.ZalaskyA.ParkH.GillA.AgrawalA. (2019). A high-sugar diet rapidly enhances susceptibility to colitis via depletion of luminal short-chainfatty acids in mice.Sci. Rep.9:12294. 10.1038/s41598-019-48749-2 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/31444382) - [CrossRef](https://doi.org/10.1038/s41598-019-48749-2) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=M..%2BLaffin&author=R..%2BFedorak&author=A..%2BZalasky&author=H..%2BPark&author=A..%2BGill&author=A..%2BAgrawal&publication_year=2019&title=A%2Bhigh-sugar%2Bdiet%2Brapidly%2Benhances%2Bsusceptibility%2Bto%2Bcolitis%2Bvia%2Bdepletion%2Bof%2Bluminal%2Bshort-chainfatty%2Bacids%2Bin%2Bmice.&journal=Sci.+Rep.&volume=9) - 33 LawrenceJ. V.FischerJ. E.SuttonT. S.WeiserH. H. (1956). Adaptation of the rat to a higher lactose diet, effect of the size of the cecum.Ohio J. Sci.5687–92. - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J.%2BV..%2BLawrence&author=J.%2BE..%2BFischer&author=T.%2BS..%2BSutton&author=H.%2BH..%2BWeiser&publication_year=1956&title=Adaptation%2Bof%2Bthe%2Brat%2Bto%2Ba%2Bhigher%2Blactose%2Bdiet%2C%2Beffect%2Bof%2Bthe%2Bsize%2Bof%2Bthe%2Bcecum.&journal=Ohio+J.+Sci.&volume=56&pages=87-92) - 34 LiuzziJ. P.HeviaP. (1998). In well-fed young rats, lactose-induced chronic diarrhea reduces the apparent absorption of vitamins A and E and affects preferentially vitamin E status.J. Nutr.1282467–2472. 10.1093/jn/128.12.2467 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/9868195) - [CrossRef](https://doi.org/10.1093/jn/128.12.2467) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J.%2BP..%2BLiuzzi&author=P..%2BHevia&publication_year=1998&title=In%2Bwell-fed%2Byoung%2Brats%2C%2Blactose-induced%2Bchronic%2Bdiarrhea%2Breduces%2Bthe%2Bapparent%2Babsorption%2Bof%2Bvitamins%2BA%2Band%2BE%2Band%2Baffects%2Bpreferentially%2Bvitamin%2BE%2Bstatus.&journal=J.+Nutr.&volume=128&pages=2467-2472) - 35 MuschM. W.BooksteinC.XieY.SellinJ. H.ChangE. B. (2001). SCFA increase intestinal Na absorption by induction of NHE3 in rat colon and human intestinal C2/bbe cells.Am. J. Physiol. Gastrointest. Liver Physiol.280G687–G693. 10.1152/ajpgi.2001.280.4.G687 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/11254495) - [CrossRef](https://doi.org/10.1152/ajpgi.2001.280.4.G687) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=M.%2BW..%2BMusch&author=C..%2BBookstein&author=Y..%2BXie&author=J.%2BH..%2BSellin&author=E.%2BB..%2BChang&publication_year=2001&title=SCFA%2Bincrease%2Bintestinal%2BNa%2Babsorption%2Bby%2Binduction%2Bof%2BNHE3%2Bin%2Brat%2Bcolon%2Band%2Bhuman%2Bintestinal%2BC2%2Fbbe%2Bcells.&journal=Am.+J.+Physiol.+Gastrointest.+Liver+Physiol.&volume=280&pages=G687-G693) - 36 RitzhauptA.WoodI. S.EllisA.HosieK. B.Shirazi-BeecheyS. P. (1998). Identification and characterization of a monocarboxylate transporter (MCT1) in pig and human colon: its potential to transport L-lactate as well as butyrate.J. Physiol.513(Pt 3)719–732. 10.1111/j.1469-7793.1998.719ba.x - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/9824713) - [CrossRef](https://doi.org/10.1111/j.1469-7793.1998.719ba.x) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BRitzhaupt&author=I.%2BS..%2BWood&author=A..%2BEllis&author=K.%2BB..%2BHosie&author=S.%2BP..%2BShirazi-Beechey&publication_year=1998&title=Identification%2Band%2Bcharacterization%2Bof%2Ba%2Bmonocarboxylate%2Btransporter%2B%28MCT1%29%2Bin%2Bpig%2Band%2Bhuman%2Bcolon%3A%2Bits%2Bpotential%2Bto%2Btransport%2BL-lactate%2Bas%2Bwell%2Bas%2Bbutyrate.&journal=J.+Physiol.&volume=513%28Pt+3%29&pages=719-732) - 37 SivaprakasamS.BhutiaY. D.YangS.GanapathyV. (2017). Short-chain fatty acid transporters: role in colonic homeostasis.Compr. Physiol.8299–314. 10.1002/cphy.c170014 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/29357130) - [CrossRef](https://doi.org/10.1002/cphy.c170014) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=S..%2BSivaprakasam&author=Y.%2BD..%2BBhutia&author=S..%2BYang&author=V..%2BGanapathy&publication_year=2017&title=Short-chain%2Bfatty%2Bacid%2Btransporters%3A%2Brole%2Bin%2Bcolonic%2Bhomeostasis.&journal=Compr.+Physiol.&volume=8&pages=299-314) - 38 SubramanyaS. B.RajendranV. M.SrinivasanP.NandaK. N. S.BinderH. J. (2007). Differential regulation of cholera toxin-inhibited Na-H exchange isoforms by butyrate in rat ileum.Am. J. Physiol. Gastrointest. Liver. Physiol.293G857–G863. 10.1152/ajpgi.00462.2006 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/17690171) - [CrossRef](https://doi.org/10.1152/ajpgi.00462.2006) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=S.%2BB..%2BSubramanya&author=V.%2BM..%2BRajendran&author=P..%2BSrinivasan&author=K.%2BN.%2BS..%2BNanda&author=H.%2BJ..%2BBinder&publication_year=2007&title=Differential%2Bregulation%2Bof%2Bcholera%2Btoxin-inhibited%2BNa-H%2Bexchange%2Bisoforms%2Bby%2Bbutyrate%2Bin%2Brat%2Bileum.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=293&pages=G857-G863) - 39 SwagertyD. L.Jr.WallingA. D.KleinR. M. (2002). Lactose intolerance.Am. Fam. Physician.651845–1850. - [Google Scholar](http://scholar.google.com/scholar_lookup?author=D.%2BL..%2BSwagerty&author=A.%2BD..%2BWalling&author=R.%2BM..%2BKlein&publication_year=2002&title=Lactose%2Bintolerance.&journal=Am.+Fam.+Physician.&volume=65&pages=1845-1850) - 40 SzilagyiA. (2015). Adaptation to lactose in lactase non persistent people: Effects on intolerance and the relationship between Dairy Food consumption and evalution of diseases.Nutrients76751–6779. 10.3390/nu7085309 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/26287234) - [CrossRef](https://doi.org/10.3390/nu7085309) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BSzilagyi&publication_year=2015&title=Adaptation%2Bto%2Blactose%2Bin%2Blactase%2Bnon%2Bpersistent%2Bpeople%3A%2BEffects%2Bon%2Bintolerance%2Band%2Bthe%2Brelationship%2Bbetween%2BDairy%2BFood%2Bconsumption%2Band%2Bevalution%2Bof%2Bdiseases.&journal=Nutrients&volume=7&pages=6751-6779) - 41 TanJ.McKenzieC.PotamitisM.ThorburnA. N.MackayC. R.MaciaL. (2014). The role of short-chain fatty acids in health and disease.Adv. Immunol.12191–119. 10.1016/B978-0-12-800100-4.00003-9 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/24388214) - [CrossRef](https://doi.org/10.1016/B978-0-12-800100-4.00003-9) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J..%2BTan&author=C..%2BMcKenzie&author=M..%2BPotamitis&author=A.%2BN..%2BThorburn&author=C.%2BR..%2BMackay&author=L..%2BMacia&publication_year=2014&title=The%2Brole%2Bof%2Bshort-chain%2Bfatty%2Bacids%2Bin%2Bhealth%2Band%2Bdisease.&journal=Adv.+Immunol.&volume=121&pages=91-119) - 42 ThaparN.SandersonI. R. (2004). Diarrhoea in children: an interface between developing and developed countries.Lancet363641–653. 10.1016/S0140-6736(04)15599-2 - [CrossRef](https://doi.org/10.1016/S0140-6736\(04\)15599-2) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=N..%2BThapar&author=I.%2BR..%2BSanderson&publication_year=2004&title=Diarrhoea%2Bin%2Bchildren%3A%2Ban%2Binterface%2Bbetween%2Bdeveloping%2Band%2Bdeveloped%2Bcountries.&journal=Lancet&volume=363&pages=641-653) - 43 van de HeijningB. J.SchipperL.VoogdE.OostingA.van der BeekE. M. (2015). Acute and chronic effects of dietary lactose in adult rats are not explained by residual intestinal lactase activity.Nutrients75542–5555. 10.3390/nu7075237 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/26184291) - [CrossRef](https://doi.org/10.3390/nu7075237) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=B.%2BJ..%2Bvan%2Bde%2BHeijning&author=L..%2BSchipper&author=E..%2BVoogd&author=A..%2BOosting&author=E.%2BM..%2Bvan%2Bder%2BBeek&publication_year=2015&title=Acute%2Band%2Bchronic%2Beffects%2Bof%2Bdietary%2Blactose%2Bin%2Badult%2Brats%2Bare%2Bnot%2Bexplained%2Bby%2Bresidual%2Bintestinal%2Blactase%2Bactivity.&journal=Nutrients&volume=7&pages=5542-5555) - 44 VidyasagarS.RamakrishnaB. S. (2002). Effects of butyrate on active sodium and chloride transport in rat and rabbit distal colon.J. Physiol.539(Pt 1)163–173. 10.1113/jphysiol.2001.013056 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/11850510) - [CrossRef](https://doi.org/10.1113/jphysiol.2001.013056) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=S..%2BVidyasagar&author=B.%2BS..%2BRamakrishna&publication_year=2002&title=Effects%2Bof%2Bbutyrate%2Bon%2Bactive%2Bsodium%2Band%2Bchloride%2Btransport%2Bin%2Brat%2Band%2Brabbit%2Bdistal%2Bcolon.&journal=J.+Physiol.&volume=539%28Pt+1%29&pages=163-173) - 45 WalkerN. M.SimpsonJ. E.YenP. F.GillR. K.RigsbyE. V.BrazillJ. M. (2008). Down-regulated in adenoma Cl/HCO3 exchanger couples with Na/H exchanger 3 for NaCl absorptionin murine small intestine.Gastroenterology1351645–1653. - [Google Scholar](http://scholar.google.com/scholar_lookup?author=N.%2BM..%2BWalker&author=J.%2BE..%2BSimpson&author=P.%2BF..%2BYen&author=R.%2BK..%2BGill&author=E.%2BV..%2BRigsby&author=J.%2BM..%2BBrazill&publication_year=2008&title=Down-regulated%2Bin%2Badenoma%2BCl%2FHCO3%2Bexchanger%2Bcouples%2Bwith%2BNa%2FH%2Bexchanger%2B3%2Bfor%2BNaCl%2Babsorptionin%2Bmurine%2Bsmall%2Bintestine.&journal=Gastroenterology&volume=135&pages=1645-1653) - 46 WangY.ShengH. F.HeY.WuJ. Y.JiangY. X.TamN. F. (2012). Comparison of the levels of bacterial diversity in fresh water, intertidal wetland, and marine sediments by using millions of Illumina Tags.Appl. Environ. Microbiol.78:8264. 10.1128/AEM.01821-12 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23001654) - [CrossRef](https://doi.org/10.1128/AEM.01821-12) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=Y..%2BWang&author=H.%2BF..%2BSheng&author=Y..%2BHe&author=J.%2BY..%2BWu&author=Y.%2BX..%2BJiang&author=N.%2BF..%2BTam&publication_year=2012&title=Comparison%2Bof%2Bthe%2Blevels%2Bof%2Bbacterial%2Bdiversity%2Bin%2Bfresh%2Bwater%2C%2Bintertidal%2Bwetland%2C%2Band%2Bmarine%2Bsediments%2Bby%2Busing%2Bmillions%2Bof%2BIllumina%2BTags.&journal=Appl.+Environ.+Microbiol.&volume=78) - 47 WardlawT.SalamaP.BrocklehurstC.ChopraM.MasonE. (2010). Diarrhoea: why children are still dying and what can be done.Lancet375870–872. 10.1016/S0140-6736(09)61798-0 - [CrossRef](https://doi.org/10.1016/S0140-6736\(09\)61798-0) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T..%2BWardlaw&author=P..%2BSalama&author=C..%2BBrocklehurst&author=M..%2BChopra&author=E..%2BMason&publication_year=2010&title=Diarrhoea%3A%2Bwhy%2Bchildren%2Bare%2Bstill%2Bdying%2Band%2Bwhat%2Bcan%2Bbe%2Bdone.&journal=Lancet&volume=375&pages=870-872) - 48 WindeyK.HoubenE.DerooverL.VerbekeK. (2015). Contribution of colonic fermentation and fecal water toxicity to the pathophysiology of lactose-intolerance.Nutrients77505–7522. 10.3390/nu7095349 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/26371036) - [CrossRef](https://doi.org/10.3390/nu7095349) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=K..%2BWindey&author=E..%2BHouben&author=L..%2BDeroover&author=K..%2BVerbeke&publication_year=2015&title=Contribution%2Bof%2Bcolonic%2Bfermentation%2Band%2Bfecal%2Bwater%2Btoxicity%2Bto%2Bthe%2Bpathophysiology%2Bof%2Blactose-intolerance.&journal=Nutrients&volume=7&pages=7505-7522) - 49 XueH.TianY. M.YanM.YangN.XingY.et al (2007). Appearance of segmental discrepancy of anion transport in rat distal colon.Biol. Pharm. Bull.301407–1411. 10.1248/bpb.30.1407 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/17666794) - [CrossRef](https://doi.org/10.1248/bpb.30.1407) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H..%2BXue&author=Y.%2BM..%2BTian&author=M..%2BYan&author=N..%2BYang&author=Y..%2BXing&publication_year=2007&title=Appearance%2Bof%2Bsegmental%2Bdiscrepancy%2Bof%2Banion%2Btransport%2Bin%2Brat%2Bdistal%2Bcolon.&journal=Biol.+Pharm.+Bull.&volume=30&pages=1407-1411) - 50 YajimaT.InoueR.MatsumotoM.YajimaM. (2011). Non-neuronal release of ACh plays a key role in secretory response to luminal propionate in rat colon.J. Physiol.589(Pt 4)953–962. 10.1113/jphysiol.2010.199976 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/21135046) - [CrossRef](https://doi.org/10.1113/jphysiol.2010.199976) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T..%2BYajima&author=R..%2BInoue&author=M..%2BMatsumoto&author=M..%2BYajima&publication_year=2011&title=Non-neuronal%2Brelease%2Bof%2BACh%2Bplays%2Ba%2Bkey%2Brole%2Bin%2Bsecretory%2Bresponse%2Bto%2Bluminal%2Bpropionate%2Bin%2Brat%2Bcolon.&journal=J.+Physiol.&volume=589%28Pt+4%29&pages=953-962) - 51 ZhaiS.ZhuL.QinS.LiL. (2018). Effect of lactulose intervention on gut microbiota and short chain fatty acid composition of C57BL/6J mice.Microbiologyopen7:e00612. 10.1002/mbo3.612 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/29575825) - [CrossRef](https://doi.org/10.1002/mbo3.612) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=S..%2BZhai&author=L..%2BZhu&author=S..%2BQin&author=L..%2BLi&publication_year=2018&title=Effect%2Bof%2Blactulose%2Bintervention%2Bon%2Bgut%2Bmicrobiota%2Band%2Bshort%2Bchain%2Bfatty%2Bacid%2Bcomposition%2Bof%2BC57BL%2F6J%2Bmice.&journal=Microbiologyopen&volume=7) ## Summary Keywords lactose, diarrhea, microbiota, SCFA, Na\+ Citation Xue H, Zhang M, Ma J, Chen T, Wang F and Tang X (2020) Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon. Front. Physiol.* 11:877. doi: [10\.3389/fphys.2020.00877](http://dx.doi.org/10.3389/fphys.2020.00877) Received 04 March 2020 Accepted 29 June 2020 Published 29 July 2020 Volume 11 - 2020 Edited by Kusum K. Kharbanda, University of Nebraska Medical Center, United States Reviewed by Waddah Alrefai, University of Illinois at Chicago, United States; Shubha Priyamvada, University of Illinois at Chicago, United States Updates ![Crossmark icon](https://www.frontiersin.org/ap-2024/images/crossmark_color.webp) Check for updates Copyright © 2020 Xue, Zhang, Ma, Chen, Wang and Tang. This is an open-access article distributed under the terms of the [Creative Commons Attribution License (CC BY)](http://creativecommons.org/licenses/by/4.0/). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. \Correspondence:* Hong Xue, [xuehong03@163.com](mailto:xuehong03@163.com); Fengyun Wang, [wfy811@163.com](mailto:wfy811@163.com); Xudong Tang, [txdly@sina.com.cn](mailto:txdly@sina.com.cn); [txdly@sina.com](mailto:txdly@sina.com) This article was submitted to Gastrointestinal Sciences, a section of the journal Frontiers in Physiology Disclaimer All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. ### Editor & Reviewers Edited by [KKKusum K. Kharbanda University of Nebraska Medical Center, United States](https://loop.frontiersin.org/people/470144) Reviewed by [SPShubha Priyamvada University of Illinois Chicago, United States](https://loop.frontiersin.org/people/724377) [WAWaddah Alrefai University of Illinois Chicago, United States](https://loop.frontiersin.org/people/935581) Frontiers' quality ## How do we build trust in science? Behind each Frontiers journal is an editorial board committed to upholding research integrity and scientific quality [Learn more](https://www.frontiersin.org/about/quality) [Published inFrontiers in Physiology Gastrointestinal Sciences3\.4 impact factor 7\.3** citescore](https://www.frontiersin.org/journals/physiology) Article metrics [View details](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#metrics) [Download PDF](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/pdf) Download other formats - [ReadCube](http://www.readcube.com/articles/10.3389/fphys.2020.00877) - [EPUB](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/epub) - [XML](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/xml) Cite article Share article - [PDF](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/pdf) Download other format - [ReadCube](http://www.readcube.com/articles/10.3389/fphys.2020.00877) - [EPUB](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/epub) - [XML](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/xml) - [Outline](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#outline) - [Figures](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#figures) - [Cite](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#cite) - [Share](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#share) - [Metrics](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#metrics) - [Suppl. material](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#supplementaryMaterial) - [Abstract](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#h1) - [Introduction](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#S1) - [Materials and Methods](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#S2) - [Results](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#S3) - [Data availability statement](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#h5) - [Ethics statement](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#h6) - [Author contributions](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#h7) - [Funding](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#h8) - [Acknowledgments](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#h9) - [Conflict of interest](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#h10) - [Supplementary material](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#S9) - [References](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#h12) Figures and Tables - FIGURE 1 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g001.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F1) - FIGURE 2 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g002.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2) - FIGURE 3 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g003.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F3) - FIGURE 4 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g004.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4) - FIGURE 5 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g005.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F5) - FIGURE 6 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g006.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F6) - FIGURE 7 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g007.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7) - FIGURE 8 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g008.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F8) - FIGURE 9 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g009.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F9) - FIGURE 10 ![](https://www.frontiersin.org/files/Articles/540252/xml-images/fphys-11-00877-g010.webp) [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F10) - TABLE 1 Comparison of the severity of diarrhea after single high lactose (30 or 40%) or incremental high lactose diet (30%/40%/50%) feeding for 3 weeks. [View in article](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#T1) Copy to clipboard Citation Copy citation Export citation file - [BibTex](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/bibTex) - [EndNote](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/endNote) - [Reference Manager](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/reference) - [Simple Text file](https://public-pages-files-2025.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/text) - [Facebook](https://www.facebook.com/sharer/sharer.php?u=https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full) - [X](https://www.twitter.com/share?url=https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full) - [LinkedIn](https://www.linkedin.com/share?url=https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full) - [Email](<mailto:?subject=Interesting science article: Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon&body=Hi!!%0D%0A%0D%0AI think you might find interesting the article "Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon".%0D%0A%0D%0AYou can read more about it here: https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full>) - [WeChat]() - Table 1.XLS - Data Sheet 1.PDF - Image 1.TIF - Guidelines - [Author guidelines](https://www.frontiersin.org/guidelines/author-guidelines) - [Services for authors](https://www.frontiersin.org/for-authors/author-services) - [Policies and publication ethics](https://www.frontiersin.org/guidelines/policies-and-publication-ethics) - [Editor guidelines](https://www.frontiersin.org/guidelines/editor-guidelines) - [Fee policy](https://www.frontiersin.org/about/fee-policy) - Explore - [Articles](https://www.frontiersin.org/articles) - [Research Topics](https://www.frontiersin.org/research-topics) - [Journals](https://www.frontiersin.org/journals) - [How we publish](https://www.frontiersin.org/about/how-we-publish) - Outreach - [Frontiers Forum](https://forum.frontiersin.org/) - [Frontiers Policy Labs](https://policylabs.frontiersin.org/) - [Frontiers for Young Minds](https://kids.frontiersin.org/) - [Frontiers Planet Prize](https://www.frontiersin.org/about/frontiers-planet-prize) - Connect - [Help center](https://helpcenter.frontiersin.org/) - [Emails and alerts](https://subscription-management.frontiersin.org/emails/preferences#block0) - [Contact us](https://www.frontiersin.org/about/contact) - [Submit](https://www.frontiersin.org/submission/submit) - [Career opportunities](https://careers.frontiersin.org/) Follow us © 2026 Frontiers Media SA. All rights reserved. [Privacy policy](https://www.frontiersin.org/legal/privacy-policy) \\| [Terms and conditions](https://www.frontiersin.org/legal/terms-and-conditions) \\| [Accessibility statement](https://www.frontiersin.org/about/accessibility-statement) Share on WeChat Scan with WeChat to share this article
Readable Markdown	## Abstract Diarrhea is one of the major abdominal symptoms in lactose-intolerant subjects. The changes in the large intestinal luminal environment and disorder of the epithelial ion transport in lactose-induced diarrhea remain unclear. The present study aimed to investigate the effect of an incremental high-lactose diet (IHLD, 30%/40%/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. Gut microbiota were analyzed by 16S rRNA amplicon sequencing and the concentration of SCFAs by gas chromatography, galactose, lactose and lactic acid through assay kit; Ussing chamber was performed to detect basal and stimulated ion transport; The expression and location of SCFA transporters, the Na-H exchanger 3(NHE3), cystic fibrosis transporter regulater (CFTR) and NKCC1 in the colon mucosa were analyzed by western and immunostaining. The concentrations of lactose, galactose and lactic acid of the cecal content were markedly increased (P \< 0.01) and SCFA concentration was significantly decreased (P \< 0.01). This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and increased relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. The expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels, and decreases in delta basal short circuit current after apical Na\+ removal in the colonic mucosa of the IHLD group contributed to Na\+ accumulation in the lumen and decrease stimulated Cl– secretion with low CFTR and NKCC1 expression would compensate for water and electrolyte loss during the diarrhea process. These results indicated that the persistence of the diarrhea state was maintained by abnormal colonic microbiota fermentation leading to high concentrations of lactose, galactose and lactic acid and low SCFAs in the lumen, and decreased Na\+ absorption with the low NHE3 expression and phosphorylation levels. ## Introduction Diarrhea is a highly prevalent and bothersome disorder, particularly in children and the elderly. According to the WHO, it is estimated that 577,000 children aged \<5 years and 502,000 adults aged \>70 years will die from diarrheal diseases worldwide ([Thapar and Sanderson, 2004](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B42); [Bryce et al., 2005](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B11); [Wardlaw et al., 2010](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B47)). Long-standing diarrhea causes malnutrition, which in turn leads to more difficulty in treating. Approximately 70% of the world’s population has hypolactasia after weaning, resulting in lactose malabsorption or lactose intolerance, defined as the presence of gastrointestinal symptoms such as bloating, rumbling, abdominal pain, nausea and diarrhea ([Swagerty et al., 2002](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B39); [Bayless et al., 2017](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B4); [Fassio et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B17)). As we know, lactose intolerance-induced diarrhea belongs to osmotic diarrhea, thereby resulting in colonic water and electrolyte accumulation ([Hammer and Hammer, 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B20)). It is believed that the osmotic load is not only caused by undigested lactose but that the colonic fermentation capacity plays a role in lactose intolerance ([He et al., 2006](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B22)). Lactose is fermented by the colonic resident microbiota into a series of intermediate and end-product metabolites, including lactate, formate, succinate and short-chain fatty acids (SCFAs), including acetate, propionate and butyrate ([He et al., 2006](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B22); [Windey et al., 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B48)). Some reports have indicated that the osmolality of lactose-induced diarrhea is closely linked to the lactose content and the production of SCFAs in the colon ([Binder, 2010](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B5); [Alexandre et al., 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B2)). SCFAs are the main anions of the colon, which have been demonstrated to be novel regulators of colonic ion transport ([Yajima et al., 2011](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B50); [Kaji et al., 2016](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B27)). Therefore, we speculated that the mechanism of lactose-induced diarrhea involved a change in SCFAs or lactate leading to a disturbance in colonic epithelial ion transport resulting in diarrhea. In the process of the transport of SCFAs, monocarboxylate (MCT1) and sodium MCT1 (sMCT1) transporters play an important role in mediating SCFA influx into the blood from the lumen ([Ritzhaupt et al., 1998](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B36); [Ganapathy et al., 2005](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B19); [Sivaprakasam et al., 2017](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B37)). It is commonly recognized that diarrhea results from excessive secretion and/or impaired absorption of fluid and electrolytes across the intestinal epithelium. Excessive fluid secretion is caused by active chloride secretion into the intestinal lumen, which drives secondary movement of sodium and water ([Binder et al., 1991](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B7); [Hoque et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B23)). Chloride secretion involves the activation of chloride channel(s), such as CFTR, on the apical plasma membrane, and it is transported into the cell at the basolateral membrane by a Na/K/Cl symporter (NKCC1, also known as SLC12A2) ([Kunzelmann and Mall, 2002](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B30)). Na\+ absorption includes electrogenic Na\+ absorption mediated by epithelial Na\+ channels (ENaC), whereas electroneutral Na\+ absorption is mediated by the Na-H exchanger (NHE) and Cl–\-HCO3 \- exchanger (an anion exchanger; AE) ([Binder et al., 1987](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B6)). NHE3 mediates both HCO3\-dependent and butyrate-dependent Na\+ absorption in the normal gut, which is regulated by butyrate ([Subramanya et al., 2007](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B38)), inducing NHE3 expression and increasing Na\+ absorption in the rat colon ([Musch et al., 2001](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B35); [Vidyasagar and Ramakrishna, 2002](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B44)). Although some studies demonstrated that undigested lactose and SCFAs induce diarrhea secondary to osmotically induced accumulation of ions and water in the colon ([Christopher and Bayless, 1971](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B12); [Hammer et al., 1989](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B21)), the change in the large intestinal luminal environment and disorder of the epithelial ion transport mechanism of lactose-induced chronic diarrhea remained unclear. Therefore, the objective of the study was to investigate the effect of an incremental high-lactose diet (IHLD, 30%/40%/50%) on luminal microbiota, microbiota-derived metabolite concentrations and colonic ion transport. The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbiota and Na\+ absorption. ## Materials and Methods ### Animals and Diarrhea Induction Using an Incremental High Lactose Diet The experimental procedures followed the guidelines and practices of the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). The procedures were conducted in accordance with the Beijing Administration Office Committee of Laboratory Animals. Male Wistar rats (350–400 g) were housed under an artificial 12 h light-12 dark cycle (lights on at 08:00 h). Forty rats were fed a standard chow diet ad libitum and had free access to water for 4 days prior to the induction of diarrhea. Then, all rats were randomly divided into 4 groups of 10 animals each. The control group was fed a standard chow diet; the 30% lactose group was fed 30% lactose for 3 weeks; the 40% lactose group was fed 40% lactose for 3 weeks; and the IHLD group was fed 30–40–50% IHLD, which consisted of 30% lactose for the first week, 40% lactose for the second week and 50% lactose for the third week ([Figure 1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F1)). An IHLD containing 30, 40, and 50% lactose in place of starch was fed to rats (Keao Xieli Feed Co Ltd., Beijing). Rats were monitored for changes in the consistency of pellets and stool mass and fecal fluid. Rats were considered diarrheic if they produced watery, soft, yellowish stools compared to normal, pliable, soft, well-formed pellets as previously described by other researchers ([Boakye et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B8)). FIGURE 1 ### DNA Extraction and PCR Amplification Cecal microbiota DNA was extracted using the Omega Stool DNA Kit (Qiagen, United States) and applied to amplification of the V3-V4 region of 16S rDNA with the gene-specific primers ACTCCTACGGGAGGCAGCAG and GGACTACHVGGGTWTCTAAT.PCR reactions were performed on a Mastercycler Gradient (Eppendorf, Germany) using 25 μl reaction volumes containing 12.5 μl of 2× Taq Plus Master Mix, 1 μl of forward primer (5 μM), 1 μl of reverse primer (5 μM), 3 μL of BSA (2 ng/μL), 5 μl of DNA (total template quantity is 30 ng), and 2.5 μl of ddH2O. PCR amplification was as follows: initiation at 94°C for 5 min, followed by 28 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, with a final extension of 72°C for 7 min. Three PCR products per sample were pooled to mitigate reaction-level PCR biases. The PCR products were purified using a QIAquick Gel Extraction Kit (QIAGEN, Germany), quantified using Real Time PCR, and sequenced at Allwegene Company, Beijing. ### High-Throughput Sequencing Deep sequencing was performed on the MiSeq platform at Allwegene Company (Beijing). After the run, image analysis, base calling and error estimation were performed using Illumina Analysis Pipeline Version 2.6. ### Data Analyses The raw data were first screened, and sequences were removed from consideration if they were shorter than 200 bp, had a low quality score (≤20), contained ambiguous bases or did not exactly match primer sequences and barcode tags. Qualified reads were separated using the sample-specific barcode sequences and trimmed with Illumina Analysis Pipeline Version 2.6. Then, the dataset was analyzed using QIIME. The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97% ([Edgar, 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B16)) to generate rarefaction curves and to calculate the richness and diversity indices. The Ribosomal Database Project (RDP) Classifier tool was used to classify all sequences into different taxonomic groups ([Cole et al., 2009](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B14)). To examine the similarity between different samples, clustering analyses and PCA were used based on the OTU information from each sample using R ([Wang et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B46)). The evolution distances between microbial communities from each sample were calculated using the tayc coefficient and represented as an Unweighted Pair Group Method with Arithmetic Mean (UPGMA) clustering tree describing the dissimilarity (1-similarity) between multiple samples ([Jiang et al., 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B26)). A Newick-formatted tree file was generated through this analysis. To compare the membership and structure of communities in different samples, heat maps were generated with the top 20 OTUs using Mothur ([Jami et al., 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B25)). ### SCFA, Lactose, Galactose and Lactic Acid Quantity The cecal contents were simply sampled in sterile tubes. Samples were kept frozen at −80°C until analysis. The samples were removed from the freezer, and 1,200 μL of water was added to each thawed sample. The samples were vortexed for 1 min until the material was homogenized. The SCFA content was determined by gas chromatography. Chromatographic analysis was carried out using an Agilent GC system with a flame ionization detector (FID) (Shimadzu Corp, Kyoto, Japan). Fused silica capillary columns 30 m × 0.25 mm coated with 0.25 μm film thickness were used. Nitrogen was used as the carrier gas. The oven temperature was 250°C, and the FID and injection port were set to 300 and 250°C, respectively. The injected sample volume was 1 μL, and the run time for each analysis was 32 min. The chromatograms and data integration were carried out using a Shimadzu C-R5A Chromatopac. The method was performed according to reference ([David et al., 2014](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B15)). Lactose, galactose and lactic acid were detected by corresponding assay kits (ELAC-100, EGAL-100 and ECLC-100, respectively, Bioassay Systems, Hayward, CA, United States) according to the instructions. An aliquot of 50 mg of cecal and proximal colon content samples was dissolved in deionized water, vortexed for 20 s and centrifuged at 12,000 × g for 10 min at 4°C. The supernatant was eluted from HLB cartridges and evaporated to dryness under a nitrogen stream. Then, 50 μl of deionized water was added to the tube and redissolved. ### Ussing Chamber Experiments The distal colon was cut longitudinally along the mesenteric border. The serosa, muscularis and submucosa layers were stripped away with fine forceps to prepare a mucosa sample. Stripped mucosa was mounted in a modified Ussing Chamber in a tissue holder (Easy Mount Chamber; Physiologic Instruments, San Diego, CA, United States) with an aperture surface area of 0.3 cm2. Each sample was bathed bilaterally in Krebs-Henseleit solution (KHS). A short-circuit current was measured in vitro in Ussing chambers. Transepithelial PD was then clamped at 0 mV, and the short-circuit current (ISC) was recorded with a VCCMC6 voltage-current clamp amplifier (Physiologic Instruments, San Diego, CA, United States). Transepithelial resistance (TR) (Ω∗cm2) was measured by altering the membrane potential in a stepwise fashion (0.1 mV) and calculated from the ohmic relationship. ### Solutions and Chemicals Krebs-Henseleit solution (KHS) (mmol/L): NaCl, 117; KCl, 4.7; MgCl2, 1.2; KH2PO4, 1.2; NaHCO3, 24.8; CaCl2, 2.5; and glucose, 11.1. The solution was bubbled with 95% O2 and 5% CO2 to maintain a pH value of 7.4. Na\+ free: NMDGCl 117; KCl 4.7; MgCl2.6H2O 1.2; KH2PO3 1.2; choline HCO3 25; CaCl2.2H2O 2.56; GS 11.1. The indomethacin, tetrodotoxin (TTX), DPC, amiloride, and forskolin, were purchased from Sigma (St. Louis, MO, United States). Stock solutions of all the above chemicals were dissolved in DMSO. The final DMSO concentration never exceeded 0.1% (v/v). Preliminary experiments indicated that the vehicle did not alter any baseline electrophysiological parameters. ### Western Blotting Tissue samples were collected from the colon mucosa of the control and high-lactose diets. Tissues were homogenized and sonicated in cold lysis buffer with protein inhibitiors and phosphatase inhibitors (Beyotime Biotechnology, Beijing). After 30 min standing in 4°C, the samples were then centrifuged at 12,000 × g for 30 min at 4°C. The pellets were discarded, and the supernatant was used for blotting. The proteins (50 μg) were separated via 8 or 10% SDS/PAGE. The blot was washed with Tris-buffered saline containing Tween-20 (TBST) and incubated overnight at 4°C with polyclonal primary antibodies against MCT1, sMCT1, NKCC1, and CFTR ([Supplementary Table S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS1)) and the rabbit polyclonal anti-actin antibody ([Supplementary Table S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS1)). After washing with TBST, the membranes were incubated with secondary antibodies ([Supplementary Table S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS1)). ### Immunostaining The specimens were fixed with 4% paraformaldehyde for 10 min at 25°C, rinsed three times, and incubated with blocking serum for 1 h and anti-MCT, anti-sMCT1, anti-NHE3, anti-NKCC1 and anti-CFTR antibodies overnight at 4°C. After washing with PBS, the specimens were incubated with secondary antibodies. All antibodies in the experiments were shown in the [Supplementary Material](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#FS1) ([Supplementary Table S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS1)). Images were obtained using a fluorescence microscope (Leica DM2500, Germany) with 20× or 40× dry lens. ### Statistical Analyses All data are presented as the mean ± SEM. Differences between three groups were evaluated using ANOVA with Prism software (version 9.1, SAS Institute, Inc.), and those between two groups were assessed using the t\-test. The Wilcoxon t\-test was used to compare microbial communities between two groups. Principal component analysis (PCA) plots of bacterial populations were created using Metaboanalyst 3.0. LEfSe analysis of the treatment group was performed on the basis of the results of the Wilcoxon tests, and the threshold on the logarithmic linear discriminant analysis (LDA) score was 3. Significance was defined as P \< 0.05. ## Results ### Effect of IHLD-Induced Diarrhea on the Fecal Form, Fecal Fluid Content and Weight After 30% lactose administration for 48 h, we observed that the majority of rats began to produce wet, loose and yellowish stools. On the 7th day and 14th day, we changed to 40 and 50% lactose and found profuse, watery stools visibly containing lots of mucus with or without a structural pellet form ([Table 1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#T1)). Compared to 30% lactose for 3 weeks, the graded increase in the concentration of lactose avoided the adaptation of rats to lactose and exhibited considerably more diarrhea than the same concentration of 30% lactose for 3 weeks. From our data, IHLD-fed rats could induce persistent and chronic diarrhea compared with only 30 or 40% lactose for 3 weeks, which can avoid adaptation to lactose in rats ([Table 1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#T1)). In the first week, the majority of diarrheic rats (80 and 90%) showed severe diarrhea with profuse, watery stools containing mucus after 30 and 40% lactose diet. In the 3rd week, the fecal characteristics of most rats in the 30 or 40% lactose group showed loose and soft stool pellets, suggesting that diarrhea began to improve. 20% of rats in the IHLD group produced profuse, loose, wet and mucoid stools, and 40% of rats in the IHLD group produced many loose, yellowish, wet stools with or without the structural form of pellets. TABLE 1 \| \| \| \| \| \| \| \|---\|---\|---\|---\|---\|---\| \| Diets \| Form of stool after 48 h to 21st day \| \| \| \| \| \| \| Watery diarrhea + mucous (incontinence or profuse) \| Loose stools + mucous (non-structural stool) \| Loose stool with structural form of pellet \| Soft formed pellets \| Hardened normal pellets \| \| Standard chow diet \| – \| – \| – \| \++ \| \++++ \| \| 30% lactose diet 1st w \| \+++ \| \++ \| \+ \| \+ \| – \| \| 40% lactose diet 1st w \| \++++ \| \++++ \| – \| – \| – \| \| IHLD 1st w \| \+++ \| \++ \| \+ \| \+ \| – \| \| 30% lactose diet 2nd w \| – \| \+ \| \+ \| \+ \| – \| \| 40% lactose diet 2nd w \| \++ \| \++ \| \++ \| – \| – \| \| IHLD 2rd w \| \+ \| \++ \| \+ \| \+ \| – \| \| 30% lactose diet 3rd w \| \+ \| – \| \++ \| \++ \| \+ \| \| 40% lactose diet \| – \| \+ \| \++ \| \+ \| – \| \| 3rd w IHLD 3rd w \| \+ \| \+ \| \++ \| \+ \| – \| Comparison of the severity of diarrhea after single high lactose (30 or 40%) or incremental high lactose diet (30%/40%/50%) feeding for 3 weeks. IHLD: incremental high-lactose diet 1st w: the first week, 2nd w: second week, 3rd w: third week. Qualitative assessment score or classification: – condition not observed, + is the observed once/day; ++ is the observed twice/day. +++ is the observed 3–4 times/day, ++++ is the abundantly observed and +++++ is the almost exclusively observed. The IHLD caused a significant increase in fecal fluid content, as fluid content constituted 79% of stool mass compared with 16% in pellets produced by rats fed the standard diet ([Figure 2A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2); P \< 0.001). Furthermore, IHLD significantly decreased the fecal pH value compared with that of control rats ([Figure 2B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2), P \< 0.001). In addition, an IHLD significantly decreased weight ([Figure 2C](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2)), similar to previous studies ([Liuzzi and Hevia, 1998](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B34); [Boakye et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B8)). The everyday average food consumption and water intake were mildly decreased compared to those of the control group ([Figures 2D,E](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2)). The average urine volume were almost same among the four groups ([Figure 2F](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F2)). FIGURE 2 ### Microbial Dysbiosis After Incremental High-Lactose Diet Incremental high-lactose diet induced significant alterations in the composition of the luminal microbiota of the cecum by 16S rRNA-Amplicon sequencing. A total of 14 samples from the two groups were analyzed by high-throughput pyrosequencing, which generated 1,133,201 clean tags. After IHLD, the Shannon and Chao 1 indexes revealed that the diversity and richness of the microbial communities were significantly lower than those in the control group ([Figure 3A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F3)). Briefly, the results of PCA (Principal component analysis) showed that the composition of the luminal microbiota of IHLD formed a totally different cluster in the ordination plot, suggesting that IHLD caused major changes in the gut microbiome profiles ([Figure 3B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F3)). FIGURE 3 Univariate analysis (LDA effect size) was performed to identify the key phyla and genera that exhibited large alterations in microbial composition after IHLD ([Figure 4A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4)). At the phylum level, the abundance of Bacteroidetes (16.54% versus 0.029%) and Verrucomicrobia (1.01% versus 0.0036%) significantly decreased, whereas that of Proteobacteria significantly increased after IHLD (0.58% versus 6.28%) ([Figure 4B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4) and [Supplementary Table S2](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS2)). At the genus level, the abundance of 139 genera showed significant differences between the two groups. The IHLD group showed a marked increase compared to the control group in the relative abundances of Bifidobacterium (0.004% versus 1.12%), Escherichia-Shigella (0.02% versus 5.7%), Megamonas (0.23% versus 20.33%), and Lactobacillus (21.85% versus 70.85%) ([Figure 4B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4) and [Supplementary Table S2](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS2)). In contrast, the concentrations of 59 genera were decreased to zero in the IHLD group, as shown in the [Supplementary Table S2](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#TS2), including SCFA-producing bacteria such as Ruminococcaceae UCG-013 ([Figure 4C](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F4)), Lachnospiraceae UCG-001 and Lachnospiraceae FCS020 group, also including lactose-fermenting Roseburia species increased by administration of a highly purified short-chain galactooligosaccharide (GOS) ([Azcarate-Peril et al., 2017](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B3)). FIGURE 4 Correlation analyses were performed to identify the relationships between microbial genera and lactose fermentation products including lactose, galactose, lactate and SCFAs. The results showed the relative abundances of four genera, including Lactobacillus, Bifidobacterium, Megamonas and Escherichia Shigella, showing a strong relationship with lactose, galactose and lactate ([Figure 5](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F5)). Among them, the relative abundance of lactobacilli, as the best-known lactic acid-producing bacteria, was 3.3-fold higher in IHLD than in the control. Another 16 genera, especially Allobaculum, Akkermansia, Lactobacillus, Bifidobacterium, and Bacteroides, with very low relative abundances showed a close association with the concentration of SCFAs. FIGURE 5 ### SCFA, Lactose, Galactose and Lactic Acid Quantification in the Cecal Luminal Contents The SCFA concentration is high in the cecum and proximal colon since SCFAs are produced by microbial fermentation in the cecum ([Tan et al., 2014](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B41); [Kuwahara et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B31)). Therefore, we investigated the concentration of SCFAs in the cecum. Lactose, galactose, lactic acid and SCFAs were quantified in cecal contents in the control and model groups. Interestingly, a significant decrease in the concentration of SCFAs was observed in the intestinal contents in the IHLD group in contrast to the control group. Acetate, propionate and butyrate were 140% lower in the cecum in the model group than in the control group, as presented in [Figures 6A,B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F6), suggesting that SCFA production was lower in the colon. In contrast, lactose, galactose and lactic acid concentrations were 10-, 6-, and 15-fold higher in the IHLD group, respectively than in the control group ([Figure 6C](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F6)). The results suggested that the high concentrations of lactose, lactic acid and galactose in the colon lumen but not SCFAs led to hyperosmosis in the colon, which would be the major reason for diarrhea. FIGURE 6 ### Expression and Location of MCT and sMCT1 in the Colon of the IHLD Group and Control Group MCT1 is an H\+\-coupled transporter expressed in the apical membrane and basolateral membrane of the colonic epithelium ([Ritzhaupt et al., 1998](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B36); [Kirat et al., 2009](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B29)), mediating SCFA influx from the lumen and SCFA efflux into the blood ([Iwanaga et al., 2006](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B24)). The western blot results showed that the expression level of MCT1 protein in the colon of the IHLD group was lower by 65% than that in the control group ([Figures 7A,B](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)). Moreover, the number and intensity of MCT1 immunopositive cells were greatly decreased in lactose-fed rats ([Figures 7E,F](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)) compared with control animals ([Figures 7C,D](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)), confirming the western blot results. FIGURE 7 sMCT1 is a Na\+\-coupled transporter expressed solely on the apical membrane of the colonic epithelium that mediates SCFA influx from the lumen ([Ritzhaupt et al., 1998](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B36); [Kuwahara et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B31)). The western blot results showed that the expression level of sMCT1 did not change in IHLD rats compared to the control rats, as shown in [Figure 7A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7), consistent with the immunofluorescence results ([Figures 7G,H](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)). ### Involvement of Na\+ Absorption and Anion Secretion in the Colon of the IHLD-Induced Diarrhea Group In order to investigate the basal and stimulated ion transport in the colonic epithelium of the IHLD group, a Ussing Chamber experiment was performed. In short circuit current recording, the basal current represents a summation of all ionic currents across the epithelium ([Xue et al., 2007](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B49); [Clarke, 2009](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B13)). The basal ISC was lower in the IHLD-model group (IHLD: 48 ± 5.15 μA/cm2 versus control: 108 ± 37.23 μA/cm2, n = 10, [Figure 7A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)). In apical Na\+\-free KHS, the basal ISC without apical Na\+ absorption in the colonic mucosa of the control group was similar to that of the IHLD group (IHDL: −86.42 ± 7.8 μA/cm2 versus control: −89.69 ± 11.41 μA/cm2, n = 11). However, the Δbasal ISC (subtract the basal ISC in apical Na\+\-free KHS from the basal ISC in normal KHS) in the colonic mucosa of the IHLD group was significantly decreased (IHLD 134.4 ± 2.65 μA/cm2 versus control: 197.8 ± 25.82 μA/cm2, n = 10, [Figure 7A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F7)), suggesting that Na\+ absorption was lower in the IHLD group. After apical treatment with the ENaC inhibitor amiloride, a similar inhibition of basal ISC was observed in the control and IHLD groups, excluding the ENaC involved in the ion transport of the IHLD group (IHLD: −6.54 ± 1.73 μA/cm2 versus control: −6.98 ± 2.22 μA/cm2, [Supplementary Figure S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#FS1)). As [Figure 8](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F8) shown, the results of western blotting and immunostaining showed that the level of total protein expression and phosphorylation of NHE3 protein-mediated Na\+ absorption in the colon were downregulated by 37 and 67% respectively, in the model group compared with the control group ([Figures 8B–G](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F8)), which was responsible for the low Na\+ absorption. FIGURE 8 Furthermore, the cAMP elevator forskolin (1 μM, basolateral)-induced ISC increase in the colon of the IHLD group was lower than that in the control group (IHLD: 128.3 ± 15.3 μA/cm2 versus control: 201.4 ± 28.31 μA/cm2, [Figure 9A](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F9)). The inhibition of basal ISC induced by apical treatment with a known CFTR inhibitor DPC (diphenylamine-2, 2′-dicarboxylic acid), was significantly higher in the control group than in the IHLD group, suggesting that CFTR-mediated Cl– secretion under basal conditions was decreased in the IHLD group compared with the control group (IHLD: −1.12 ± 1.74 μA/cm2 versus control: −8.10 ± 2.14 μA/cm2, [Supplementary Figure S1](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#FS1)). The western blot and immunostaining results showed that the protein expression levels of NKCC1 and CFTR in the colonic mucosa were decrease by 50 and 24%,respectively, than those in the control group, contributing to the lower basal and stimulated ion secretion in the model group ([Figures 9B–G](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F9)). FIGURE 9 ### Discussion Lactose intolerance (LI) appears to be mainly associated with unabsorbed lactose in the small intestine passing into the colon and being metabolized by colonic bacteria to organic acids, including lactic acid and short-chain fatty acids. The organic acids escaping absorption by the colon remain in the colonic lumen and lead to osmotic diarrhea. Previous studies have shown that lactose-induced diarrhea results, in large part, from the combination of net fluid secretion by the stomach and small intestine and interference with net fluid absorption in the colon ([Christopher and Bayless, 1971](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B12); [Hammer et al., 1989](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B21)). In our study, we established a chronic diarrhea model using lactose with a gradual increase in concentration for 3 weeks to investigate the mechanism of high lactose-induced diarrhea on organic acid production and ion transport of the colonic epithelium and NHE3, CFTR and NKCC1 expression combined with epithelial locations, which are associated with Na\+ absorption and Cl– secretion. The concentrations of lactose, galactose and lactic acid in the cecum in the IHLD model group were higher than those in the control group, but the concentration of SCFAs was lower, suggesting that the major reason for hyperosmosis is due to high concentrations of lactose, galactose and lactic acid in the intestinal lumen, which could cause osmotic diarrhea. Furthermore, the concentration of lactic acid in the cecum content was much higher than that in the control group, which was responsible for the low pH in the feces. Adult rats, as mammals, have intestinal lactase activity that decreases quickly upon weaning, and research has shown that although residual lactase activity is present in adult rats, a high-lactose diet is poorly digested by adult rats ([Alexandre et al., 2013](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B2); [van de Heijning et al., 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B43)). The increase in galactose in the cecum contents after chronic feeding with high lactose might be due to microbiota fermentation. As expected, our results showed that significant differences were observed in the composition of cecum microbiota via high-throughput MiSeq sequencing after IHLD. A previous study ([Francavilla et al., 2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B18)) investigated the influence of lactose on the composition of the gut microbiota and the SCFAs of infants with cow’s milk allergy. Similar to our findings, lactose intake can induce an increase in Bifidobacteria and Lactobacilli and a decrease in the numbers of Bacteroides, Prevotella and Clostridia. In addition, we also found that the increased abundances of another two genera, Escherichia-shigella and Megamonas, were positively related to the concentrations of lactose, galactose and lactic acid and might be responsible for the IHLD-induced diarrhea. They also measured SCFA levels and found that the concentration of SCFA increased after addition of lactose, which was the opposite result of our study because of the differences between from infants and adults. In addition, we found the loss of important SCFA-producing microbes, such as lachnospiraceae NK4A136 group and ruminococcaceae UCG-005, after IHLD, which might lead to the lower concentration of luminal SCFAs, consistent with a recent study on a high-sugar diet ([Laffin et al., 2019](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B32)). Another recent study ([Kamphuis et al., 2019](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B28)) showed that oral gavage with lactose at a modest dose of 5 mg/day for 3 weeks did not induce alterations in the fecal microbiota of mice, which was different from our study because of the low dose of lactose without significant malabsorption. In our results, we found that the concentrations of SCFAs in the cecal contents of the model group was significantly decreased compared with that of the control group, which was different from a previous study that showed that an increase in SCFAs resulted in acute ingestion of lactose in vivo and in vitro ([He et al., 2006](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B22); [Windey et al., 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B48)). Few studies have focused on the effect of chronic lactose intervention on SCFAs, and a recent study ([Zhai et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B51)) found no significant difference in the SCFA concentration of feces after 3 weeks of lactulose intervention in mice, suggesting a different mechanism between acute and chronic ingestion. In the colon, SCFAs are absorbed by MCT1 and sMCT1 in the colon epithelium. Our results showed that an unaltered expression level and differential distribution of sMCT1 were observed between the control group and IHLD group. However, MCT1 expression was significantly decreased, showing that its low expression level might be caused by lower SCFAs in the lumen, which is also reported to be regulated by butyrate ([Borthakur et al., 2008](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B10), [2012](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B9)). Currently, there is growing evidence indicating that SCFAs are a product of bacterial fermentation involved in the regulation of ion transport ([Yajima et al., 2011](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B50); [Tan et al., 2014](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B41); [Kuwahara et al., 2018](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B31)). Previous studies demonstrated that luminal addition of propionate stimulates chloride secretion, which function as a lubricant for the movement of luminal contents in the colon ([Yajima et al., 2011](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B50)). It has been reported that NHE3 mediates Na\+ absorption in the colon, and our data showed that its expression and phosphorylation level were significantly decreased in the model group, confirming a decrease in Na\+ absorption. The results of the Ussing Chamber demonstrated that when apical Na\+ was removed, the delta basal ISC in the IHLD group was significantly decreased, suggesting that Na\+ absorption was involved in the basal current. It is generally accepted that the absorption of Na\+ and Cl– in the colon is mutually interdependent, electrically neutral by largely apical Na/H exchange and Cl/HCO3 exchange processes, primarily involving the Na/H exchanger NHE3 and the Cl/HCO3 exchanger ([Walker et al., 2008](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B45)). The evidence from the present study showed that Na\+ absorption and NHE3 protein expression and phosphorylation were decreased in IHLD rats compared with control rats, but the RNA level of NHE3 and the change in the expression of the Cl/HCO3 exchanger involving Cl– absorption still need to be investigated. To the best of our knowledge, no previous report has found that NHE3 is involved in lactose-induced diarrhea and might be a novel target for the attenuation of lactose-induced diarrhea. In this study, we used the chronic diarrhea model induced by giving high lactose for 3 weeks, which could employ a compensatory mechanism to adapt to the diarrhea situation. A previous study showed that rats adapted to a lactose diet and that the size of the cecum returned to normal, but its mechanisms are not clear ([Lawrence et al., 1956](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B33); [Szilagyi, 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B40)). Our results showed that basal current and FSK-induced Cl– secretion in the model group were lower than those in the control group, which can result in lower luminal anionic secretion and associated luminal transport of water. Furthermore, the NKCC1 and CFTR expression levels in the colon mucosa in the model group decreased compared with those in the control group, resulting in a decrease in basal and FSK-induced ISC. We considered it to have resulted from the compensatory mechanism. In the duodenum, luminal SCFAs induced HCO3 \- secretion ([Akiba et al., 2015](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#B1)). Our study showed that lower luminal SCFAs decrease Cl– secretion, but the mechanism should be investigated further. Taken together, IHLD feeding to rats caused a persistent state of diarrhea, and the cecum tripled in size. The concentrations of lactose, galactose and lactic acid were markedly increased in the cecal luminal contents, contributing to lactose intolerance-induced high osmosis diarrhea. Meanwhile, the lumen SCFA concentration of the cecal contents was significantly decreased. This was associated with depletion of the Lachnospiraceae NK4A136 group and Ruminococcaceae UCG-005 and an increase in the relative abundance of Lactobacillus, escherichia-shigella and megamonas in the cecal microbiota. In addition, the microbiota diversity in the colon was found to be lower in the cecum of IHLD rats compared with control rats. Concomitantly, the expression of monocarboxylate transporter 1 was decreased in the colonic mucosa of the IHLD group. Low NHE3 expression and phosphorylation levels in the colonic mucosa of the IHLD group contributed to the Na\+ absorption and accumulation decrease in the lumen, and the stimulated Cl– secretion decrease would be a compensatory effect for water and electrolyte loss during the diarrhea process ([Figure 10](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#F10)). The present study provides new evidence for the physiopathological mechanism of lactose intolerance-induced high osmosis diarrhea and new ideas for therapy through modulating the gut microbita and Na\+ absorption. FIGURE 10 ## Statements ### Ethics statement The animal study was reviewed and approved by the Animal Care Ethics Committee of Xiyuan Hospital (Permission code: 2019XLC004-2). ### Author contributions HX, FW, and XT conceived the study. HX designed the experiment, wrote the manuscript, and performed the western blotting and immunostaining. MZ and JM made the animal models and performed the Ussing Chamber experiments. HX quantified SCFAs. HX and TC analyzed the data. FW and XT supervised the research. All authors contributed to the article and approved the submitted version. ### Funding This work was supported by the National Natural Science Foundation of China (Grant No. 81973838) and National Key Research and Development Project (Grant No. 2016YFC1302203). ### Acknowledgments The authors thank Prof. Wang Jiannong and Dr. Sun Caixia for their help for technical support on GC analyses for measuring SCFA levels. ### Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. ### Supplementary material The Supplementary Material for this article can be found online at: [https://www.frontiersin.org/articles/10.3389/fphys.2020.00877/full\#supplementary-material](https://www.frontiersin.org/journals/physiology/articles/10.3389/fphys.2020.00877/full#supplementary-material) FIGURE S1 Comparison of effect of DPC or amiloride on the basal ISC current between control and IHLD group. Values are means ± SEM; P \< 0.05. TABLE S1 Antibodies for western and immunofluorescence. TABLE S2 Information of statistical test analysis of phylum and genus level between control and IHLD group. ## References - 1 AkibaY.InoueT.KajiI.NarimatsuK.IwamotoK.et al (2015). Short-chain fatty acid sensing in rat duodenum.J. Physiol.593585–599. 10.1113/jphysiol.2014.280792 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/25433076) - [CrossRef](https://doi.org/10.1113/jphysiol.2014.280792) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=Y..%2BAkiba&author=T..%2BInoue&author=I..%2BKaji&author=K..%2BNarimatsu&author=K..%2BIwamoto&publication_year=2015&title=Short-chain%2Bfatty%2Bacid%2Bsensing%2Bin%2Brat%2Bduodenum.&journal=J.+Physiol.&volume=593&pages=585-599) - 2 AlexandreV.EvenP. C.LarueA. C.BlouinJ. M.BlachierF.BenamouzigR.et al (2013). Lactose malabsorption and colonic fermentations alter host metabolism in rats.Br. J. Nutr.110625–631. 10.1017/S0007114512005557 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23321004) - [CrossRef](https://doi.org/10.1017/S0007114512005557) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=V..%2BAlexandre&author=P.%2BC..%2BEven&author=A.%2BC..%2BLarue&author=J.%2BM..%2BBlouin&author=F..%2BBlachier&author=R..%2BBenamouzig&publication_year=2013&title=Lactose%2Bmalabsorption%2Band%2Bcolonic%2Bfermentations%2Balter%2Bhost%2Bmetabolism%2Bin%2Brats.&journal=Br.+J.+Nutr.&volume=110&pages=625-631) - 3 Azcarate-PerilM. A.RitterA. J.SavaianoD.Monteagudo-MeraA.AndersonC.MagnessS. T. (2017). Impact of the short-chain galactooligosaccharides on the gut microbiome of lactose-intolerant individuals.Proc. Natl. Acad. Sci. U.S.A.114E367–E375. 10.1073/pnas.1606722113 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/28049818) - [CrossRef](https://doi.org/10.1073/pnas.1606722113) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=M.%2BA..%2BAzcarate-Peril&author=A.%2BJ..%2BRitter&author=D..%2BSavaiano&author=A..%2BMonteagudo-Mera&author=C..%2BAnderson&author=S.%2BT..%2BMagness&publication_year=2017&title=Impact%2Bof%2Bthe%2Bshort-chain%2Bgalactooligosaccharides%2Bon%2Bthe%2Bgut%2Bmicrobiome%2Bof%2Blactose-intolerant%2Bindividuals.&journal=Proc.+Natl.+Acad.+Sci.+U.S.A.&volume=114&pages=E367-E375) - 4 BaylessT. M.BrownE.PaigeD. M. (2017). Lactase Non-persistence and Lactose Intolerance.Curr. Gastroenterol. Rep19:23. 10.1007/s11894-017-0558-9 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/28421381) - [CrossRef](https://doi.org/10.1007/s11894-017-0558-9) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T.%2BM..%2BBayless&author=E..%2BBrown&author=D.%2BM..%2BPaige&publication_year=2017&title=Lactase%2BNon-persistence%2Band%2BLactose%2BIntolerance.&journal=Curr.+Gastroenterol.+Rep&volume=19) - 5 BinderH. J. (2010). Role of Colonic Short-chain fatty acid transport in diarrhea.*Annu. Rev. Physiol.72297–313. 10.1146/annurev-physiol-021909-135817 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/20148677) - [CrossRef](https://doi.org/10.1146/annurev-physiol-021909-135817) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BJ..%2BBinder&publication_year=2010&title=Role%2Bof%2BColonic%2BShort-chain%2Bfatty%2Bacid%2Btransport%2Bin%2Bdiarrhea.&journal=Annu.+Rev.+Physiol.&volume=72&pages=297-313) - 6 BinderH. J.FosterE. S.BudingerM. E.HayslettJ. P. (1987). Mechanism of electroneutral sodium chloride absorption in distal colon of the rat.Gastroenterology93449–455. 10.1016/0016-5085(87)90905-x - [CrossRef](https://doi.org/10.1016/0016-5085\(87\)90905-x) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BJ..%2BBinder&author=E.%2BS..%2BFoster&author=M.%2BE..%2BBudinger&author=J.%2BP..%2BHayslett&publication_year=1987&title=Mechanism%2Bof%2Belectroneutral%2Bsodium%2Bchloride%2Babsorption%2Bin%2Bdistal%2Bcolon%2Bof%2Bthe%2Brat.&journal=Gastroenterology&volume=93&pages=449-455) - 7 BinderH. J.SandleG. I.RajendranV. M. (1991). “Colonic fluid and electrolyte transport in health and disease,” in The Large Intestine: Physiology, Pathophysiology, and Disease, edsPhillipsS. F.PembertonJ. H.ShorterR. G. (New York, NY: Raven Press), 141–168. - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BJ..%2BBinder&author=G.%2BI..%2BSandle&author=V.%2BM..%2BRajendran&publication_year=1991&title=Colonic%2Bfluid%2Band%2Belectrolyte%2Btransport%2Bin%2Bhealth%2Band%2Bdisease&journal=The+Large+Intestine%3A+Physiology%2C+Pathophysiology%2C+and+Disease&pages=141-168) - 8 BoakyeP. A.BrierleyS. M.BalembaO. B. (2012). Garcinia buchananii bark extract is an effective anti-diarrheal remedy for lactose-induced diarrhea.J. Ethnopharmacol.142539–547. 10.1016/j.jep.2012.05.034 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22643232) - [CrossRef](https://doi.org/10.1016/j.jep.2012.05.034) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=P.%2BA..%2BBoakye&author=S.%2BM..%2BBrierley&author=O.%2BB..%2BBalemba&publication_year=2012&title=Garcinia%2Bbuchananii%2Bbark%2Bextract%2Bis%2Ban%2Beffective%2Banti-diarrheal%2Bremedy%2Bfor%2Blactose-induced%2Bdiarrhea.&journal=J.+Ethnopharmacol.&volume=142&pages=539-547) - 9 BorthakurA.PriyamvadaS.KumarA.NatarajanA. A.GillR. K.AlrefaiW. A.et al (2012). A novel nutrient sensing mechanism underlies substrate-induced regulation of monocarboxylate transporter 1.Am. J. Physiol. Gastrointest. Liver. Physiol.303G1126–G1133. 10.1152/ajpgi.00308.2012 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22982338) - [CrossRef](https://doi.org/10.1152/ajpgi.00308.2012) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BBorthakur&author=S..%2BPriyamvada&author=A..%2BKumar&author=A.%2BA..%2BNatarajan&author=R.%2BK..%2BGill&author=W.%2BA..%2BAlrefai&publication_year=2012&title=A%2Bnovel%2Bnutrient%2Bsensing%2Bmechanism%2Bunderlies%2Bsubstrate-induced%2Bregulation%2Bof%2Bmonocarboxylate%2Btransporter%2B1.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=303&pages=G1126-G1133) - 10 BorthakurA.SaksenaS.GillR. K.AlrefaiW. A.RamaswamyK.DudejaP. K. (2008). Regulation of monocarboxylate transporter 1 (MCT1) promoter by butyrate in human intestinal epithelial cells: Involvement of NF-κB pathway.J. Cell. Biochem.1031452–1463. 10.1002/jcb.21532 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/17786924) - [CrossRef](https://doi.org/10.1002/jcb.21532) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BBorthakur&author=S..%2BSaksena&author=R.%2BK..%2BGill&author=W.%2BA..%2BAlrefai&author=K..%2BRamaswamy&author=P.%2BK..%2BDudeja&publication_year=2008&title=Regulation%2Bof%2Bmonocarboxylate%2Btransporter%2B1%2B%28MCT1%29%2Bpromoter%2Bby%2Bbutyrate%2Bin%2Bhuman%2Bintestinal%2Bepithelial%2Bcells%3A%2BInvolvement%2Bof%2BNF-%CE%BAB%2Bpathway.&journal=J.+Cell.+Biochem.&volume=103&pages=1452-1463) - 11 BryceJ.BoschiP. C.ShibuyaK.BlackR. E. (2005). WHO estimates of the causes of death in children.Lancet3651147–1152. 10.1016/S0140-6736(05)71877-8 - [CrossRef](https://doi.org/10.1016/S0140-6736\(05\)71877-8) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J..%2BBryce&author=P.%2BC..%2BBoschi&author=K..%2BShibuya&author=R.%2BE..%2BBlack&publication_year=2005&title=WHO%2Bestimates%2Bof%2Bthe%2Bcauses%2Bof%2Bdeath%2Bin%2Bchildren.&journal=Lancet&volume=365&pages=1147-1152) - 12 ChristopherN. L.BaylessT. M. (1971). Role of the small bowel and colon in lactose-induced diarrhea.Gastroenterology60845–852. 10.1016/s0016-5085(71)80083-5 - [CrossRef](https://doi.org/10.1016/s0016-5085\(71\)80083-5) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=N.%2BL..%2BChristopher&author=T.%2BM..%2BBayless&publication_year=1971&title=Role%2Bof%2Bthe%2Bsmall%2Bbowel%2Band%2Bcolon%2Bin%2Blactose-induced%2Bdiarrhea.&journal=Gastroenterology&volume=60&pages=845-852) - 13 ClarkeL. L. (2009). A guide to Ussing chamber studies of mouse intestine.Am. J. Physiol. Gastrointest. Liver. Physiol.296G1151–G1166. 10.1152/ajpgi.90649.2008 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/19342508) - [CrossRef](https://doi.org/10.1152/ajpgi.90649.2008) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=L.%2BL..%2BClarke&publication_year=2009&title=A%2Bguide%2Bto%2BUssing%2Bchamber%2Bstudies%2Bof%2Bmouse%2Bintestine.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=296&pages=G1151-G1166) - 14 ColeJ. R.WangQ. E.CardenasJ.FishB.ChaiR. J.FarrisA. S.et al (2009). The ribosomal database project: improved alignments and new tools for rRNA analysis.Nucleic Acids Res.37D141–D145. 10.1093/nar/gkn879 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/19004872) - [CrossRef](https://doi.org/10.1093/nar/gkn879) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J.%2BR..%2BCole&author=Q.%2BE..%2BWang&author=J..%2BCardenas&author=B..%2BFish&author=R.%2BJ..%2BChai&author=A.%2BS..%2BFarris&publication_year=2009&title=The%2Bribosomal%2Bdatabase%2Bproject%3A%2Bimproved%2Balignments%2Band%2Bnew%2Btools%2Bfor%2BrRNA%2Banalysis.&journal=Nucleic+Acids+Res.&volume=37&pages=D141-D145) - 15 DavidL. A.MauriceC. F.ButtonJ. E.WolfeB. E.et al (2014). Diet rapidly and reproducibly alters the human gut microbiome.Nature505559–563. 10.1038/nature12820 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/24336217) - [CrossRef](https://doi.org/10.1038/nature12820) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=L.%2BA..%2BDavid&author=C.%2BF..%2BMaurice&author=J.%2BE..%2BButton&author=B.%2BE..%2BWolfe&publication_year=2014&title=Diet%2Brapidly%2Band%2Breproducibly%2Balters%2Bthe%2Bhuman%2Bgut%2Bmicrobiome.&journal=Nature&volume=505&pages=559-563) - 16 EdgarR. C. (2013). UPARSE: Highly accurate OTU sequences from microbial amplicon reads.Nat Methods10996–998. 10.1038/nmeth.2604 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23955772) - [CrossRef](https://doi.org/10.1038/nmeth.2604) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=R.%2BC..%2BEdgar&publication_year=2013&title=UPARSE%3A%2BHighly%2Baccurate%2BOTU%2Bsequences%2Bfrom%2Bmicrobial%2Bamplicon%2Breads.&journal=Nat+Methods&volume=10&pages=996-998) - 17 FassioF.FacioniM. S.GuagniniF. (2018). Lactose maldigestion, malabsorption, and intolerance: a comprehensive review with focus on current management and future perspectives.Nutrients10:1599. 10.3390/nu10111599 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/30388735) - [CrossRef](https://doi.org/10.3390/nu10111599) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=F..%2BFassio&author=M.%2BS..%2BFacioni&author=F..%2BGuagnini&publication_year=2018&title=Lactose%2Bmaldigestion%2C%2Bmalabsorption%2C%2Band%2Bintolerance%3A%2Ba%2Bcomprehensive%2Breview%2Bwith%2Bfocus%2Bon%2Bcurrent%2Bmanagement%2Band%2Bfuture%2Bperspectives.&journal=Nutrients&volume=10) - 18 FrancavillaR.CalassoM.CalaceL.SiragusaS.NdagijimanaM.VernocchiP.et al (2012). Effect of lactose on gut microbiota and metabolome of infants with cow’s milk allergy.Pediatr. Allergy Immunol.3420–427. 10.1111/j.1399-3038.2012.01286.x - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22435727) - [CrossRef](https://doi.org/10.1111/j.1399-3038.2012.01286.x) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=R..%2BFrancavilla&author=M..%2BCalasso&author=L..%2BCalace&author=S..%2BSiragusa&author=M..%2BNdagijimana&author=P..%2BVernocchi&publication_year=2012&title=Effect%2Bof%2Blactose%2Bon%2Bgut%2Bmicrobiota%2Band%2Bmetabolome%2Bof%2Binfants%2Bwith%2Bcow%E2%80%99s%2Bmilk%2Ballergy.&journal=Pediatr.+Allergy+Immunol.&volume=3&pages=420-427) - 19 GanapathyV.GopalE.MiyauchiS.PrasadP. D. (2005). Biological functions of SLC5A8,candidate tumour suppressor.Biochem. Soc. Trans.33(Pt 1)237–240. 10.1042/BST0330237 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/15667316) - [CrossRef](https://doi.org/10.1042/BST0330237) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=V..%2BGanapathy&author=E..%2BGopal&author=S..%2BMiyauchi&author=P.%2BD..%2BPrasad&publication_year=2005&title=Biological%2Bfunctions%2Bof%2BSLC5A8%2Ccandidate%2Btumour%2Bsuppressor.&journal=Biochem.+Soc.+Trans.&volume=33%28Pt+1%29&pages=237-240) - 20 HammerH. F.HammerJ. (2012). Diarrhea caused by carbohydrate malabsorption.Gastroenterol. Clin. N. Am.41611–627. 10.1016/j.gtc.2012.06.003 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22917167) - [CrossRef](https://doi.org/10.1016/j.gtc.2012.06.003) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BF..%2BHammer&author=J..%2BHammer&publication_year=2012&title=Diarrhea%2Bcaused%2Bby%2Bcarbohydrate%2Bmalabsorption.&journal=Gastroenterol.+Clin.+N.+Am.&volume=41&pages=611-627) - 21 HammerH. F.Santa AnaC. A.SchillerL. R.FordtranJ. S. (1989). Studies of osmotic diarrhea induced in normal subjects by ingestion of polyethylene glycol and lactulose.J. Clin. Invest.841056–1062. 10.1172/JCI114267 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/2794043) - [CrossRef](https://doi.org/10.1172/JCI114267) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H.%2BF..%2BHammer&author=C.%2BA..%2BSanta%2BAna&author=L.%2BR..%2BSchiller&author=J.%2BS..%2BFordtran&publication_year=1989&title=Studies%2Bof%2Bosmotic%2Bdiarrhea%2Binduced%2Bin%2Bnormal%2Bsubjects%2Bby%2Bingestion%2Bof%2Bpolyethylene%2Bglycol%2Band%2Blactulose.&journal=J.+Clin.+Invest.&volume=84&pages=1056-1062) - 22 HeT.PriebeM. G.HarmsenH. J.StellaardF.SunX.WellingG. W.et al (2006). Colonic fermentation may play a role in lactose intolerance in humans.J. Nutr.13658–63. 10.1093/jn/136.1.58 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/16365059) - [CrossRef](https://doi.org/10.1093/jn/136.1.58) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T..%2BHe&author=M.%2BG..%2BPriebe&author=H.%2BJ..%2BHarmsen&author=F..%2BStellaard&author=X..%2BSun&author=G.%2BW..%2BWelling&publication_year=2006&title=Colonic%2Bfermentation%2Bmay%2Bplay%2Ba%2Brole%2Bin%2Blactose%2Bintolerance%2Bin%2Bhumans.&journal=J.+Nutr.&volume=136&pages=58-63) - 23 HoqueK. M.ChakrabortyS.SheikhI. A.WoodwardO. M. (2012). New advances in the pathophysiology of intestinal ion transport and barrier function in diarrhea and the impact on therapy.Expert Rev. Anti Infect. Ther.10687–699. 10.1586/eri.12.47 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/22734958) - [CrossRef](https://doi.org/10.1586/eri.12.47) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=K.%2BM..%2BHoque&author=S..%2BChakraborty&author=I.%2BA..%2BSheikh&author=O.%2BM..%2BWoodward&publication_year=2012&title=New%2Badvances%2Bin%2Bthe%2Bpathophysiology%2Bof%2Bintestinal%2Bion%2Btransport%2Band%2Bbarrier%2Bfunction%2Bin%2Bdiarrhea%2Band%2Bthe%2Bimpact%2Bon%2Btherapy.&journal=Expert+Rev.+Anti+Infect.+Ther.&volume=10&pages=687-699) - 24 IwanagaT.TakebeK.KatoI.KarakiS.KuwaharaA. (2006). Cellular expression of monocarboxylate transporters (MCT) in the digestive tract of the mouse, rat, and humans, with special reference to slc5a8.Biomed. Res.27243–254. 10.2220/biomedres.27.243 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/17099289) - [CrossRef](https://doi.org/10.2220/biomedres.27.243) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T..%2BIwanaga&author=K..%2BTakebe&author=I..%2BKato&author=S..%2BKaraki&author=A..%2BKuwahara&publication_year=2006&title=Cellular%2Bexpression%2Bof%2Bmonocarboxylate%2Btransporters%2B%28MCT%29%2Bin%2Bthe%2Bdigestive%2Btract%2Bof%2Bthe%2Bmouse%2C%2Brat%2C%2Band%2Bhumans%2C%2Bwith%2Bspecial%2Breference%2Bto%2Bslc5a8.&journal=Biomed.+Res.&volume=27&pages=243-254) - 25 JamiE.IsraelA.KotserA.MizrahiI. (2013). Exploring the bovine rumen bacterial community from birth to adulthood.ISME J.71069–1079. 10.1038/ismej.2013.2 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23426008) - [CrossRef](https://doi.org/10.1038/ismej.2013.2) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=E..%2BJami&author=A..%2BIsrael&author=A..%2BKotser&author=I..%2BMizrahi&publication_year=2013&title=Exploring%2Bthe%2Bbovine%2Brumen%2Bbacterial%2Bcommunity%2Bfrom%2Bbirth%2Bto%2Badulthood.&journal=ISME+J.&volume=7&pages=1069-1079) - 26 JiangX. T.PengX.DengG. H.ShengH. F.WangY.ZhouH. W. (2013). Illumina sequencing of 16S rRNA Tag revealed spatial variations of bacterial communities in a mangrove wetland.Microb. Ecol.6696–104. 10.1007/s00248-013-0238-8 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23649297) - [CrossRef](https://doi.org/10.1007/s00248-013-0238-8) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=X.%2BT..%2BJiang&author=X..%2BPeng&author=G.%2BH..%2BDeng&author=H.%2BF..%2BSheng&author=Y..%2BWang&author=H.%2BW..%2BZhou&publication_year=2013&title=Illumina%2Bsequencing%2Bof%2B16S%2BrRNA%2BTag%2Brevealed%2Bspatial%2Bvariations%2Bof%2Bbacterial%2Bcommunities%2Bin%2Ba%2Bmangrove%2Bwetland.&journal=Microb.+Ecol.&volume=66&pages=96-104) - 27 KajiI.AkibaY.KonnoK.WatanabeM.KimuraS.IwanagaT. (2016). Neural FFA3 activation inversely regulates anion secretion evoked by nicotinic ACh receptor activation in rat.J. Physiol.5943339–3352. 10.1113/JP271441 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/26854275) - [CrossRef](https://doi.org/10.1113/JP271441) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=I..%2BKaji&author=Y..%2BAkiba&author=K..%2BKonno&author=M..%2BWatanabe&author=S..%2BKimura&author=T..%2BIwanaga&publication_year=2016&title=Neural%2BFFA3%2Bactivation%2Binversely%2Bregulates%2Banion%2Bsecretion%2Bevoked%2Bby%2Bnicotinic%2BACh%2Breceptor%2Bactivation%2Bin%2Brat.&journal=J.+Physiol.&volume=594&pages=3339-3352) - 28 KamphuisJ. B. J.GuiardB.LevequeM.OlierM.JouaninI.YvonS.et al (2019). Lactose and fructo-ligosaccharides increase visceral sensitivity in mice via glycation processes, increasing mast cell density in colonic mucosa.Gastroenterology158652–663.e6. 10.1053/j.gastro.2019.10.037652663e6 - [CrossRef](https://doi.org/10.1053/j.gastro.2019.10.037652663e6) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J.%2BB.%2BJ..%2BKamphuis&author=B..%2BGuiard&author=M..%2BLeveque&author=M..%2BOlier&author=I..%2BJouanin&author=S..%2BYvon&publication_year=2019&title=Lactose%2Band%2Bfructo-ligosaccharides%2Bincrease%2Bvisceral%2Bsensitivity%2Bin%2Bmice%2Bvia%2Bglycation%2Bprocesses%2C%2Bincreasing%2Bmast%2Bcell%2Bdensity%2Bin%2Bcolonic%2Bmucosa.&journal=Gastroenterology&volume=158&pages=652-663.e6) - 29 KiratD.KondoK.ShimadaR.KatoS. (2009). Dietary pectin up-regulates monocaboxylate transporter1 in the rat gastrointestinal tract.Exp. Physiol.94422–433. 10.1113/expphysiol.2009.046797 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/19168540) - [CrossRef](https://doi.org/10.1113/expphysiol.2009.046797) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=D..%2BKirat&author=K..%2BKondo&author=R..%2BShimada&author=S..%2BKato&publication_year=2009&title=Dietary%2Bpectin%2Bup-regulates%2Bmonocaboxylate%2Btransporter1%2Bin%2Bthe%2Brat%2Bgastrointestinal%2Btract.&journal=Exp.+Physiol.&volume=94&pages=422-433) - 30 KunzelmannK.MallM. (2002). Electrolyte transport in the mammalian colon: mechanisms and implications for disease.Physiol Rev.82245–289. 10.1152/physrev.00026.2001 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/11773614) - [CrossRef](https://doi.org/10.1152/physrev.00026.2001) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=K..%2BKunzelmann&author=M..%2BMall&publication_year=2002&title=Electrolyte%2Btransport%2Bin%2Bthe%2Bmammalian%2Bcolon%3A%2Bmechanisms%2Band%2Bimplications%2Bfor%2Bdisease.&journal=Physiol+Rev.&volume=82&pages=245-289) - 31 KuwaharaA.KuwaharaY.InuiT.MarunakaY. (2018). Regulation of ion transport in the intestine by free fatty acid receptor 2 and 3: possible involvement of the diffuse chemosensory system.Int. J. Mol. Sci.19:735. 10.3390/ijms19030735 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/29510573) - [CrossRef](https://doi.org/10.3390/ijms19030735) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BKuwahara&author=Y..%2BKuwahara&author=T..%2BInui&author=Y..%2BMarunaka&publication_year=2018&title=Regulation%2Bof%2Bion%2Btransport%2Bin%2Bthe%2Bintestine%2Bby%2Bfree%2Bfatty%2Bacid%2Breceptor%2B2%2Band%2B3%3A%2Bpossible%2Binvolvement%2Bof%2Bthe%2Bdiffuse%2Bchemosensory%2Bsystem.&journal=Int.+J.+Mol.+Sci.&volume=19) - 32 LaffinM.FedorakR.ZalaskyA.ParkH.GillA.AgrawalA. (2019). A high-sugar diet rapidly enhances susceptibility to colitis via depletion of luminal short-chainfatty acids in mice.Sci. Rep.9:12294. 10.1038/s41598-019-48749-2 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/31444382) - [CrossRef](https://doi.org/10.1038/s41598-019-48749-2) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=M..%2BLaffin&author=R..%2BFedorak&author=A..%2BZalasky&author=H..%2BPark&author=A..%2BGill&author=A..%2BAgrawal&publication_year=2019&title=A%2Bhigh-sugar%2Bdiet%2Brapidly%2Benhances%2Bsusceptibility%2Bto%2Bcolitis%2Bvia%2Bdepletion%2Bof%2Bluminal%2Bshort-chainfatty%2Bacids%2Bin%2Bmice.&journal=Sci.+Rep.&volume=9) - 33 LawrenceJ. V.FischerJ. E.SuttonT. S.WeiserH. H. (1956). Adaptation of the rat to a higher lactose diet, effect of the size of the cecum.Ohio J. Sci.5687–92. - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J.%2BV..%2BLawrence&author=J.%2BE..%2BFischer&author=T.%2BS..%2BSutton&author=H.%2BH..%2BWeiser&publication_year=1956&title=Adaptation%2Bof%2Bthe%2Brat%2Bto%2Ba%2Bhigher%2Blactose%2Bdiet%2C%2Beffect%2Bof%2Bthe%2Bsize%2Bof%2Bthe%2Bcecum.&journal=Ohio+J.+Sci.&volume=56&pages=87-92) - 34 LiuzziJ. P.HeviaP. (1998). In well-fed young rats, lactose-induced chronic diarrhea reduces the apparent absorption of vitamins A and E and affects preferentially vitamin E status.J. Nutr.1282467–2472. 10.1093/jn/128.12.2467 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/9868195) - [CrossRef](https://doi.org/10.1093/jn/128.12.2467) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J.%2BP..%2BLiuzzi&author=P..%2BHevia&publication_year=1998&title=In%2Bwell-fed%2Byoung%2Brats%2C%2Blactose-induced%2Bchronic%2Bdiarrhea%2Breduces%2Bthe%2Bapparent%2Babsorption%2Bof%2Bvitamins%2BA%2Band%2BE%2Band%2Baffects%2Bpreferentially%2Bvitamin%2BE%2Bstatus.&journal=J.+Nutr.&volume=128&pages=2467-2472) - 35 MuschM. W.BooksteinC.XieY.SellinJ. H.ChangE. B. (2001). SCFA increase intestinal Na absorption by induction of NHE3 in rat colon and human intestinal C2/bbe cells.Am. J. Physiol. Gastrointest. Liver Physiol.280G687–G693. 10.1152/ajpgi.2001.280.4.G687 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/11254495) - [CrossRef](https://doi.org/10.1152/ajpgi.2001.280.4.G687) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=M.%2BW..%2BMusch&author=C..%2BBookstein&author=Y..%2BXie&author=J.%2BH..%2BSellin&author=E.%2BB..%2BChang&publication_year=2001&title=SCFA%2Bincrease%2Bintestinal%2BNa%2Babsorption%2Bby%2Binduction%2Bof%2BNHE3%2Bin%2Brat%2Bcolon%2Band%2Bhuman%2Bintestinal%2BC2%2Fbbe%2Bcells.&journal=Am.+J.+Physiol.+Gastrointest.+Liver+Physiol.&volume=280&pages=G687-G693) - 36 RitzhauptA.WoodI. S.EllisA.HosieK. B.Shirazi-BeecheyS. P. (1998). Identification and characterization of a monocarboxylate transporter (MCT1) in pig and human colon: its potential to transport L-lactate as well as butyrate.J. Physiol.513(Pt 3)719–732. 10.1111/j.1469-7793.1998.719ba.x - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/9824713) - [CrossRef](https://doi.org/10.1111/j.1469-7793.1998.719ba.x) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BRitzhaupt&author=I.%2BS..%2BWood&author=A..%2BEllis&author=K.%2BB..%2BHosie&author=S.%2BP..%2BShirazi-Beechey&publication_year=1998&title=Identification%2Band%2Bcharacterization%2Bof%2Ba%2Bmonocarboxylate%2Btransporter%2B%28MCT1%29%2Bin%2Bpig%2Band%2Bhuman%2Bcolon%3A%2Bits%2Bpotential%2Bto%2Btransport%2BL-lactate%2Bas%2Bwell%2Bas%2Bbutyrate.&journal=J.+Physiol.&volume=513%28Pt+3%29&pages=719-732) - 37 SivaprakasamS.BhutiaY. D.YangS.GanapathyV. (2017). Short-chain fatty acid transporters: role in colonic homeostasis.Compr. Physiol.8299–314. 10.1002/cphy.c170014 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/29357130) - [CrossRef](https://doi.org/10.1002/cphy.c170014) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=S..%2BSivaprakasam&author=Y.%2BD..%2BBhutia&author=S..%2BYang&author=V..%2BGanapathy&publication_year=2017&title=Short-chain%2Bfatty%2Bacid%2Btransporters%3A%2Brole%2Bin%2Bcolonic%2Bhomeostasis.&journal=Compr.+Physiol.&volume=8&pages=299-314) - 38 SubramanyaS. B.RajendranV. M.SrinivasanP.NandaK. N. S.BinderH. J. (2007). Differential regulation of cholera toxin-inhibited Na-H exchange isoforms by butyrate in rat ileum.Am. J. Physiol. Gastrointest. Liver. Physiol.293G857–G863. 10.1152/ajpgi.00462.2006 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/17690171) - [CrossRef](https://doi.org/10.1152/ajpgi.00462.2006) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=S.%2BB..%2BSubramanya&author=V.%2BM..%2BRajendran&author=P..%2BSrinivasan&author=K.%2BN.%2BS..%2BNanda&author=H.%2BJ..%2BBinder&publication_year=2007&title=Differential%2Bregulation%2Bof%2Bcholera%2Btoxin-inhibited%2BNa-H%2Bexchange%2Bisoforms%2Bby%2Bbutyrate%2Bin%2Brat%2Bileum.&journal=Am.+J.+Physiol.+Gastrointest.+Liver.+Physiol.&volume=293&pages=G857-G863) - 39 SwagertyD. L.Jr.WallingA. D.KleinR. M. (2002). Lactose intolerance.Am. Fam. Physician.651845–1850. - [Google Scholar](http://scholar.google.com/scholar_lookup?author=D.%2BL..%2BSwagerty&author=A.%2BD..%2BWalling&author=R.%2BM..%2BKlein&publication_year=2002&title=Lactose%2Bintolerance.&journal=Am.+Fam.+Physician.&volume=65&pages=1845-1850) - 40 SzilagyiA. (2015). Adaptation to lactose in lactase non persistent people: Effects on intolerance and the relationship between Dairy Food consumption and evalution of diseases.Nutrients76751–6779. 10.3390/nu7085309 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/26287234) - [CrossRef](https://doi.org/10.3390/nu7085309) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=A..%2BSzilagyi&publication_year=2015&title=Adaptation%2Bto%2Blactose%2Bin%2Blactase%2Bnon%2Bpersistent%2Bpeople%3A%2BEffects%2Bon%2Bintolerance%2Band%2Bthe%2Brelationship%2Bbetween%2BDairy%2BFood%2Bconsumption%2Band%2Bevalution%2Bof%2Bdiseases.&journal=Nutrients&volume=7&pages=6751-6779) - 41 TanJ.McKenzieC.PotamitisM.ThorburnA. N.MackayC. R.MaciaL. (2014). The role of short-chain fatty acids in health and disease.Adv. Immunol.12191–119. 10.1016/B978-0-12-800100-4.00003-9 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/24388214) - [CrossRef](https://doi.org/10.1016/B978-0-12-800100-4.00003-9) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=J..%2BTan&author=C..%2BMcKenzie&author=M..%2BPotamitis&author=A.%2BN..%2BThorburn&author=C.%2BR..%2BMackay&author=L..%2BMacia&publication_year=2014&title=The%2Brole%2Bof%2Bshort-chain%2Bfatty%2Bacids%2Bin%2Bhealth%2Band%2Bdisease.&journal=Adv.+Immunol.&volume=121&pages=91-119) - 42 ThaparN.SandersonI. R. (2004). Diarrhoea in children: an interface between developing and developed countries.Lancet363641–653. 10.1016/S0140-6736(04)15599-2 - [CrossRef](https://doi.org/10.1016/S0140-6736\(04\)15599-2) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=N..%2BThapar&author=I.%2BR..%2BSanderson&publication_year=2004&title=Diarrhoea%2Bin%2Bchildren%3A%2Ban%2Binterface%2Bbetween%2Bdeveloping%2Band%2Bdeveloped%2Bcountries.&journal=Lancet&volume=363&pages=641-653) - 43 van de HeijningB. J.SchipperL.VoogdE.OostingA.van der BeekE. M. (2015). Acute and chronic effects of dietary lactose in adult rats are not explained by residual intestinal lactase activity.Nutrients75542–5555. 10.3390/nu7075237 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/26184291) - [CrossRef](https://doi.org/10.3390/nu7075237) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=B.%2BJ..%2Bvan%2Bde%2BHeijning&author=L..%2BSchipper&author=E..%2BVoogd&author=A..%2BOosting&author=E.%2BM..%2Bvan%2Bder%2BBeek&publication_year=2015&title=Acute%2Band%2Bchronic%2Beffects%2Bof%2Bdietary%2Blactose%2Bin%2Badult%2Brats%2Bare%2Bnot%2Bexplained%2Bby%2Bresidual%2Bintestinal%2Blactase%2Bactivity.&journal=Nutrients&volume=7&pages=5542-5555) - 44 VidyasagarS.RamakrishnaB. S. (2002). Effects of butyrate on active sodium and chloride transport in rat and rabbit distal colon.J. Physiol.539(Pt 1)163–173. 10.1113/jphysiol.2001.013056 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/11850510) - [CrossRef](https://doi.org/10.1113/jphysiol.2001.013056) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=S..%2BVidyasagar&author=B.%2BS..%2BRamakrishna&publication_year=2002&title=Effects%2Bof%2Bbutyrate%2Bon%2Bactive%2Bsodium%2Band%2Bchloride%2Btransport%2Bin%2Brat%2Band%2Brabbit%2Bdistal%2Bcolon.&journal=J.+Physiol.&volume=539%28Pt+1%29&pages=163-173) - 45 WalkerN. M.SimpsonJ. E.YenP. F.GillR. K.RigsbyE. V.BrazillJ. M. (2008). Down-regulated in adenoma Cl/HCO3 exchanger couples with Na/H exchanger 3 for NaCl absorptionin murine small intestine.Gastroenterology1351645–1653. - [Google Scholar](http://scholar.google.com/scholar_lookup?author=N.%2BM..%2BWalker&author=J.%2BE..%2BSimpson&author=P.%2BF..%2BYen&author=R.%2BK..%2BGill&author=E.%2BV..%2BRigsby&author=J.%2BM..%2BBrazill&publication_year=2008&title=Down-regulated%2Bin%2Badenoma%2BCl%2FHCO3%2Bexchanger%2Bcouples%2Bwith%2BNa%2FH%2Bexchanger%2B3%2Bfor%2BNaCl%2Babsorptionin%2Bmurine%2Bsmall%2Bintestine.&journal=Gastroenterology&volume=135&pages=1645-1653) - 46 WangY.ShengH. F.HeY.WuJ. Y.JiangY. X.TamN. F. (2012). Comparison of the levels of bacterial diversity in fresh water, intertidal wetland, and marine sediments by using millions of Illumina Tags.Appl. Environ. Microbiol.78:8264. 10.1128/AEM.01821-12 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/23001654) - [CrossRef](https://doi.org/10.1128/AEM.01821-12) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=Y..%2BWang&author=H.%2BF..%2BSheng&author=Y..%2BHe&author=J.%2BY..%2BWu&author=Y.%2BX..%2BJiang&author=N.%2BF..%2BTam&publication_year=2012&title=Comparison%2Bof%2Bthe%2Blevels%2Bof%2Bbacterial%2Bdiversity%2Bin%2Bfresh%2Bwater%2C%2Bintertidal%2Bwetland%2C%2Band%2Bmarine%2Bsediments%2Bby%2Busing%2Bmillions%2Bof%2BIllumina%2BTags.&journal=Appl.+Environ.+Microbiol.&volume=78) - 47 WardlawT.SalamaP.BrocklehurstC.ChopraM.MasonE. (2010). Diarrhoea: why children are still dying and what can be done.Lancet375870–872. 10.1016/S0140-6736(09)61798-0 - [CrossRef](https://doi.org/10.1016/S0140-6736\(09\)61798-0) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T..%2BWardlaw&author=P..%2BSalama&author=C..%2BBrocklehurst&author=M..%2BChopra&author=E..%2BMason&publication_year=2010&title=Diarrhoea%3A%2Bwhy%2Bchildren%2Bare%2Bstill%2Bdying%2Band%2Bwhat%2Bcan%2Bbe%2Bdone.&journal=Lancet&volume=375&pages=870-872) - 48 WindeyK.HoubenE.DerooverL.VerbekeK. (2015). Contribution of colonic fermentation and fecal water toxicity to the pathophysiology of lactose-intolerance.Nutrients77505–7522. 10.3390/nu7095349 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/26371036) - [CrossRef](https://doi.org/10.3390/nu7095349) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=K..%2BWindey&author=E..%2BHouben&author=L..%2BDeroover&author=K..%2BVerbeke&publication_year=2015&title=Contribution%2Bof%2Bcolonic%2Bfermentation%2Band%2Bfecal%2Bwater%2Btoxicity%2Bto%2Bthe%2Bpathophysiology%2Bof%2Blactose-intolerance.&journal=Nutrients&volume=7&pages=7505-7522) - 49 XueH.TianY. M.YanM.YangN.XingY.et al (2007). Appearance of segmental discrepancy of anion transport in rat distal colon.Biol. Pharm. Bull.301407–1411. 10.1248/bpb.30.1407 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/17666794) - [CrossRef](https://doi.org/10.1248/bpb.30.1407) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=H..%2BXue&author=Y.%2BM..%2BTian&author=M..%2BYan&author=N..%2BYang&author=Y..%2BXing&publication_year=2007&title=Appearance%2Bof%2Bsegmental%2Bdiscrepancy%2Bof%2Banion%2Btransport%2Bin%2Brat%2Bdistal%2Bcolon.&journal=Biol.+Pharm.+Bull.&volume=30&pages=1407-1411) - 50 YajimaT.InoueR.MatsumotoM.YajimaM. (2011). Non-neuronal release of ACh plays a key role in secretory response to luminal propionate in rat colon.J. Physiol.589(Pt 4)953–962. 10.1113/jphysiol.2010.199976 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/21135046) - [CrossRef](https://doi.org/10.1113/jphysiol.2010.199976) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=T..%2BYajima&author=R..%2BInoue&author=M..%2BMatsumoto&author=M..%2BYajima&publication_year=2011&title=Non-neuronal%2Brelease%2Bof%2BACh%2Bplays%2Ba%2Bkey%2Brole%2Bin%2Bsecretory%2Bresponse%2Bto%2Bluminal%2Bpropionate%2Bin%2Brat%2Bcolon.&journal=J.+Physiol.&volume=589%28Pt+4%29&pages=953-962) - 51 ZhaiS.ZhuL.QinS.LiL. (2018). Effect of lactulose intervention on gut microbiota and short chain fatty acid composition of C57BL/6J mice.Microbiologyopen7:e00612. 10.1002/mbo3.612 - [Pubmed Abstract](https://pubmed.ncbi.nlm.nih.gov/29575825) - [CrossRef](https://doi.org/10.1002/mbo3.612) - [Google Scholar](http://scholar.google.com/scholar_lookup?author=S..%2BZhai&author=L..%2BZhu&author=S..%2BQin&author=L..%2BLi&publication_year=2018&title=Effect%2Bof%2Blactulose%2Bintervention%2Bon%2Bgut%2Bmicrobiota%2Band%2Bshort%2Bchain%2Bfatty%2Bacid%2Bcomposition%2Bof%2BC57BL%2F6J%2Bmice.&journal=Microbiologyopen&volume=7) Keywords lactose, diarrhea, microbiota, SCFA, Na\+ Citation Xue H, Zhang M, Ma J, Chen T, Wang F and Tang X (2020) Lactose-Induced Chronic Diarrhea Results From Abnormal Luminal Microbial Fermentation and Disorder of Ion Transport in the Colon. Front. Physiol.* 11:877. doi: [10\.3389/fphys.2020.00877](http://dx.doi.org/10.3389/fphys.2020.00877) Received 04 March 2020 Accepted 29 June 2020 Published 29 July 2020 Volume 11 - 2020 Edited by Kusum K. Kharbanda, University of Nebraska Medical Center, United States Reviewed by Waddah Alrefai, University of Illinois at Chicago, United States; Shubha Priyamvada, University of Illinois at Chicago, United States Updates Copyright © 2020 Xue, Zhang, Ma, Chen, Wang and Tang. This is an open-access article distributed under the terms of the [Creative Commons Attribution License (CC BY)](http://creativecommons.org/licenses/by/4.0/). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. \Correspondence:*** Hong Xue, [xuehong03@163.com](mailto:xuehong03@163.com); Fengyun Wang, [wfy811@163.com](mailto:wfy811@163.com); Xudong Tang, [txdly@sina.com.cn](mailto:txdly@sina.com.cn); [txdly@sina.com](mailto:txdly@sina.com) This article was submitted to Gastrointestinal Sciences, a section of the journal Frontiers in Physiology Disclaimer All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.
Shard	145 (laksa)
Root Hash	4240109820602890345
Unparsed URL	org,frontiersin!www,/journals/physiology/articles/10.3389/fphys.2020.00877/full s443